Incidental Mutation 'R0782:Zfp292'
ID76676
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Namezinc finger protein 292
SynonymsZn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location34803113-34882960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34839382 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 161 (N161S)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047950
AA Change: N161S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: N161S

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098163
AA Change: N161S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: N161S

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122250
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34808683 missense probably benign 0.15
IGL00502:Zfp292 APN 4 34809775 missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34808790 missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34807827 missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34806763 missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34807961 missense probably benign 0.01
IGL01639:Zfp292 APN 4 34809048 missense probably benign 0.04
IGL01688:Zfp292 APN 4 34807855 missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34809244 missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34808810 missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34805416 missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34806462 missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34809415 missense probably benign 0.14
IGL02715:Zfp292 APN 4 34819542 missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34806163 missense probably benign 0.00
F5770:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34807524 missense probably benign 0.00
R0153:Zfp292 UTSW 4 34811185 missense probably benign 0.26
R0184:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34806281 missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34808227 missense probably benign 0.25
R0433:Zfp292 UTSW 4 34839959 missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34810059 missense probably benign 0.28
R0555:Zfp292 UTSW 4 34807194 missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34807399 missense probably benign 0.02
R0748:Zfp292 UTSW 4 34816424 splice site probably benign
R0834:Zfp292 UTSW 4 34809114 missense probably benign 0.00
R0879:Zfp292 UTSW 4 34811218 missense probably benign 0.00
R1083:Zfp292 UTSW 4 34807569 missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34805238 missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34805397 missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34808935 missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34811237 missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34811043 missense probably benign 0.02
R1837:Zfp292 UTSW 4 34810264 missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34807452 missense probably benign 0.22
R2107:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34810266 missense probably benign 0.13
R2182:Zfp292 UTSW 4 34807417 missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34807962 missense probably benign 0.07
R2306:Zfp292 UTSW 4 34809468 missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34811281 missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34806426 missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34808814 missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34810326 missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34807744 missense probably benign 0.00
R4006:Zfp292 UTSW 4 34809611 missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34806079 missense probably benign 0.04
R4641:Zfp292 UTSW 4 34807828 missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34807078 missense probably benign 0.00
R4718:Zfp292 UTSW 4 34819521 missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34808917 missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34839878 missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34809755 missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34805842 missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34807491 missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34806261 missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34811703 missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34806747 missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34805125 missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34805464 missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34811902 missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34808497 missense probably benign 0.13
R6209:Zfp292 UTSW 4 34809442 missense probably benign 0.14
R6275:Zfp292 UTSW 4 34808883 missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34816301 missense probably benign 0.21
R6747:Zfp292 UTSW 4 34806894 missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34807812 missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34816357 missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34806796 missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34808679 missense probably benign
R7254:Zfp292 UTSW 4 34819476 missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34806839 missense probably benign
R7378:Zfp292 UTSW 4 34808384 missense probably benign 0.26
R7535:Zfp292 UTSW 4 34811487 missense probably benign 0.28
R7589:Zfp292 UTSW 4 34806777 missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34809865 missense probably benign 0.02
V7580:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGCCAGAGCACTGCACAAAG -3'
(R):5'- CTGTGTCTGCCTGTTGAGCTATCAG -3'

Sequencing Primer
(F):5'- CTCTCCTGATGAAAAGAAGTTGAG -3'
(R):5'- GCCTGTTGAGCTATCAGATAAGC -3'
Posted On2013-10-16