Incidental Mutation 'R0782:Vamp5'
ID76682
Institutional Source Beutler Lab
Gene Symbol Vamp5
Ensembl Gene ENSMUSG00000073002
Gene Namevesicle-associated membrane protein 5
SynonymsCamp
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0782 (G1)
Quality Score157
Status Validated
Chromosome6
Chromosomal Location72368794-72380468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72369470 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 48 (S48G)
Ref Sequence ENSEMBL: ENSMUSP00000098843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074231] [ENSMUST00000101285] [ENSMUST00000154098] [ENSMUST00000206154]
Predicted Effect probably damaging
Transcript: ENSMUST00000074231
AA Change: S48G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073852
Gene: ENSMUSG00000073002
AA Change: S48G

DomainStartEndE-ValueType
Pfam:Synaptobrevin 2 90 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101285
AA Change: S48G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098843
Gene: ENSMUSG00000073002
AA Change: S48G

DomainStartEndE-ValueType
Pfam:Synaptobrevin 2 90 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154098
SMART Domains Protein: ENSMUSP00000138327
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 41 81 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206154
AA Change: S29G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.5566 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of vesicles and cell membranes. The VAMP5 gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family and the SNARE superfamily. This VAMP family member may participate in vesicle trafficking events that are associated with myogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Vamp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2937:Vamp5 UTSW 6 72369340 missense probably benign 0.20
R2938:Vamp5 UTSW 6 72369340 missense probably benign 0.20
R4894:Vamp5 UTSW 6 72370198 missense possibly damaging 0.93
R6813:Vamp5 UTSW 6 72380441 unclassified probably benign
R6814:Vamp5 UTSW 6 72380441 unclassified probably benign
R6825:Vamp5 UTSW 6 72380441 unclassified probably benign
R6853:Vamp5 UTSW 6 72380441 unclassified probably benign
R6858:Vamp5 UTSW 6 72380441 unclassified probably benign
R8073:Vamp5 UTSW 6 72380453 unclassified probably benign
R8354:Vamp5 UTSW 6 72370393 start gained probably benign
R8454:Vamp5 UTSW 6 72370393 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCCTAAGGCATCACCTGCATC -3'
(R):5'- TGGTCACGGCCTGGTATTGCTAAG -3'

Sequencing Primer
(F):5'- TGCATCCTAGGCCTATGGTT -3'
(R):5'- AGCCAGGCTAGAATGGTTAC -3'
Posted On2013-10-16