Incidental Mutation 'R0782:Cog7'
ID76687
Institutional Source Beutler Lab
Gene Symbol Cog7
Ensembl Gene ENSMUSG00000034951
Gene Namecomponent of oligomeric golgi complex 7
Synonyms
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121879363-121981711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121943797 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 464 (A464S)
Ref Sequence ENSEMBL: ENSMUSP00000146193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057576] [ENSMUST00000205438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057576
AA Change: A464S

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058990
Gene: ENSMUSG00000034951
AA Change: A464S

DomainStartEndE-ValueType
Pfam:COG7 2 767 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148634
Predicted Effect possibly damaging
Transcript: ENSMUST00000205438
AA Change: A464S

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Cog7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Cog7 APN 7 121943777 critical splice donor site probably null
IGL02094:Cog7 APN 7 121963247 missense probably benign 0.21
IGL02113:Cog7 APN 7 121925480 missense probably damaging 1.00
IGL02151:Cog7 APN 7 121943808 missense probably damaging 0.97
IGL02365:Cog7 APN 7 121977736 missense possibly damaging 0.56
IGL02398:Cog7 APN 7 121964209 missense probably damaging 1.00
IGL02732:Cog7 APN 7 121923367 missense probably benign 0.05
IGL02887:Cog7 APN 7 121943844 missense possibly damaging 0.83
R0143:Cog7 UTSW 7 121951164 missense probably damaging 1.00
R0446:Cog7 UTSW 7 121937072 missense probably benign
R0521:Cog7 UTSW 7 121941169 critical splice donor site probably null
R0526:Cog7 UTSW 7 121963271 splice site probably null
R0658:Cog7 UTSW 7 121956140 splice site probably benign
R1029:Cog7 UTSW 7 121930529 critical splice donor site probably null
R1419:Cog7 UTSW 7 121955992 missense probably damaging 0.99
R1521:Cog7 UTSW 7 121930574 missense possibly damaging 0.57
R1639:Cog7 UTSW 7 121981419 missense probably damaging 1.00
R2023:Cog7 UTSW 7 121936970 missense probably damaging 0.99
R3896:Cog7 UTSW 7 121941169 critical splice donor site probably benign
R4240:Cog7 UTSW 7 121925484 missense possibly damaging 0.50
R4731:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4732:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4733:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4838:Cog7 UTSW 7 121971381 missense probably damaging 1.00
R5001:Cog7 UTSW 7 121949886 missense probably damaging 1.00
R5237:Cog7 UTSW 7 121951221 missense probably damaging 1.00
R5353:Cog7 UTSW 7 121941247 splice site probably null
R5609:Cog7 UTSW 7 121925460 missense probably benign 0.12
R5964:Cog7 UTSW 7 121956029 missense probably damaging 0.99
R6544:Cog7 UTSW 7 121935743 missense probably damaging 0.99
R6784:Cog7 UTSW 7 121964293 splice site probably null
R7110:Cog7 UTSW 7 121935776 missense probably damaging 0.98
R7212:Cog7 UTSW 7 121977314 missense probably damaging 0.98
R7304:Cog7 UTSW 7 121937139 missense probably benign 0.04
X0066:Cog7 UTSW 7 121977624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCAcacccacttttgatccag -3'
(R):5'- GCAATGGCTCATGGTTTGTCCACAC -3'

Sequencing Primer
(F):5'- caggaggcattggcagg -3'
(R):5'- GAATTCCAGCTGTCCTTCGA -3'
Posted On2013-10-16