Incidental Mutation 'R0782:Efr3b'
ID76692
Institutional Source Beutler Lab
Gene Symbol Efr3b
Ensembl Gene ENSMUSG00000020658
Gene NameEFR3 homolog B
Synonyms
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0782 (G1)
Quality Score217
Status Validated
Chromosome12
Chromosomal Location3962554-4038915 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 3984686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111178] [ENSMUST00000218166]
Predicted Effect probably benign
Transcript: ENSMUST00000111178
SMART Domains Protein: ENSMUSP00000106809
Gene: ENSMUSG00000020658

DomainStartEndE-ValueType
SCOP:d1qbkb_ 55 306 1e-3 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217677
Predicted Effect probably benign
Transcript: ENSMUST00000218166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220181
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Efr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Efr3b APN 12 3975411 nonsense probably null
IGL01288:Efr3b APN 12 3982865 missense probably damaging 1.00
IGL01467:Efr3b APN 12 3969597 missense probably damaging 0.98
IGL01964:Efr3b APN 12 3982928 missense probably damaging 1.00
IGL02253:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02329:Efr3b APN 12 3992923 splice site probably null
IGL02365:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02373:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02390:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02392:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02494:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02496:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02501:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02529:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02530:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02532:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02699:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02716:Efr3b APN 12 3984627 missense probably damaging 1.00
IGL02904:Efr3b APN 12 3984583 missense probably damaging 0.99
IGL02986:Efr3b APN 12 3966495 missense probably benign 0.13
IGL03171:Efr3b APN 12 3968622 missense probably benign 0.00
IGL03346:Efr3b APN 12 3984648 missense probably damaging 1.00
PIT4418001:Efr3b UTSW 12 3980490 missense possibly damaging 0.64
R0017:Efr3b UTSW 12 3993003 missense probably damaging 0.98
R0189:Efr3b UTSW 12 3982925 missense probably damaging 1.00
R0361:Efr3b UTSW 12 3977923 missense probably benign 0.00
R0469:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0510:Efr3b UTSW 12 3982058 missense probably benign 0.02
R2042:Efr3b UTSW 12 3984627 missense probably damaging 1.00
R2359:Efr3b UTSW 12 3980136 unclassified probably benign
R3691:Efr3b UTSW 12 3982059 missense possibly damaging 0.84
R3849:Efr3b UTSW 12 3983414 missense probably benign 0.40
R5384:Efr3b UTSW 12 3983419 missense probably benign 0.04
R5819:Efr3b UTSW 12 3992965 missense probably benign 0.21
R5970:Efr3b UTSW 12 3968590 missense possibly damaging 0.93
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6759:Efr3b UTSW 12 3984613 missense probably damaging 1.00
R6969:Efr3b UTSW 12 3968624 missense probably benign 0.08
R7392:Efr3b UTSW 12 3969588 missense probably benign
R7717:Efr3b UTSW 12 3984574 missense probably damaging 1.00
R8071:Efr3b UTSW 12 3982898 missense probably benign 0.02
R8686:Efr3b UTSW 12 4000886 missense probably damaging 1.00
R8737:Efr3b UTSW 12 3999594 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCTGTCCAAGCTAGGTGTGTTC -3'
(R):5'- ATGGATCTCATAGCTCGCCTCTGC -3'

Sequencing Primer
(F):5'- TGAGGCAATGCTCTGACAGC -3'
(R):5'- tggtccccgtctgtctc -3'
Posted On2013-10-16