Incidental Mutation 'R0783:Iars2'
ID 76703
Institutional Source Beutler Lab
Gene Symbol Iars2
Ensembl Gene ENSMUSG00000026618
Gene Name isoleucine-tRNA synthetase 2, mitochondrial
Synonyms 2010002H18Rik
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 185284726-185329396 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 185320874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 400 (E400G)
Ref Sequence ENSEMBL: ENSMUSP00000106601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000110974] [ENSMUST00000110975]
AlphaFold Q8BIJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000027921
AA Change: E400G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: E400G

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 3.6e-172 PFAM
Pfam:tRNA-synt_1g 112 268 7e-15 PFAM
Pfam:tRNA-synt_1_2 334 462 3.8e-7 PFAM
Pfam:Anticodon_1 756 920 1.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110974
AA Change: E400G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106601
Gene: ENSMUSG00000026618
AA Change: E400G

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 552 2e-130 PFAM
Pfam:tRNA-synt_1g 113 269 2.2e-17 PFAM
Pfam:tRNA-synt_1_2 293 462 9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110975
AA Change: E400G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106603
Gene: ENSMUSG00000026618
AA Change: E400G

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 1.2e-171 PFAM
Pfam:tRNA-synt_1g 113 269 3.4e-17 PFAM
Pfam:tRNA-synt_1_2 293 462 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153211
Meta Mutation Damage Score 0.6975 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Iars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Iars2 APN 1 185315954 missense probably benign 0.00
IGL00906:Iars2 APN 1 185296403 splice site probably benign
IGL01287:Iars2 APN 1 185296428 missense possibly damaging 0.90
IGL01814:Iars2 APN 1 185302775 nonsense probably null
IGL02016:Iars2 APN 1 185303306 missense probably damaging 0.99
IGL02995:Iars2 APN 1 185303301 missense probably benign
IGL03002:Iars2 APN 1 185322816 splice site probably null
IGL03248:Iars2 APN 1 185291432 unclassified probably benign
R0304:Iars2 UTSW 1 185287156 missense possibly damaging 0.77
R0711:Iars2 UTSW 1 185322388 splice site probably benign
R0990:Iars2 UTSW 1 185318627 missense probably damaging 1.00
R1867:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1868:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1957:Iars2 UTSW 1 185295671 missense possibly damaging 0.89
R2378:Iars2 UTSW 1 185327721 missense probably damaging 1.00
R3784:Iars2 UTSW 1 185287131 missense probably benign 0.17
R4061:Iars2 UTSW 1 185303386 missense possibly damaging 0.85
R4334:Iars2 UTSW 1 185303394 missense probably benign 0.35
R4708:Iars2 UTSW 1 185289357 missense probably benign 0.00
R4723:Iars2 UTSW 1 185315979 missense probably damaging 1.00
R4729:Iars2 UTSW 1 185316051 missense possibly damaging 0.71
R4851:Iars2 UTSW 1 185327648 missense probably damaging 0.99
R5033:Iars2 UTSW 1 185317928 missense possibly damaging 0.65
R5215:Iars2 UTSW 1 185294769 missense probably damaging 1.00
R5260:Iars2 UTSW 1 185323734 missense probably damaging 1.00
R5286:Iars2 UTSW 1 185323121 intron probably benign
R5614:Iars2 UTSW 1 185289508 missense probably benign 0.00
R6659:Iars2 UTSW 1 185288076 missense possibly damaging 0.76
R6838:Iars2 UTSW 1 185329145 missense probably damaging 0.98
R7057:Iars2 UTSW 1 185289367 missense probably benign 0.03
R7462:Iars2 UTSW 1 185322866 missense probably damaging 1.00
R7690:Iars2 UTSW 1 185320997 missense probably damaging 1.00
R8021:Iars2 UTSW 1 185322457 missense probably benign 0.05
R8097:Iars2 UTSW 1 185329389 unclassified probably benign
R8198:Iars2 UTSW 1 185297506 missense probably benign 0.19
R8283:Iars2 UTSW 1 185288091 nonsense probably null
R8543:Iars2 UTSW 1 185287144 missense probably benign 0.00
R8710:Iars2 UTSW 1 185295586 missense probably benign 0.13
R8713:Iars2 UTSW 1 185291418 missense possibly damaging 0.58
R8856:Iars2 UTSW 1 185296424 missense probably benign 0.10
R9206:Iars2 UTSW 1 185317949 missense possibly damaging 0.83
R9304:Iars2 UTSW 1 185323203 nonsense probably null
R9435:Iars2 UTSW 1 185302716 missense probably damaging 1.00
R9634:Iars2 UTSW 1 185295530 makesense probably null
Z1177:Iars2 UTSW 1 185315895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGCCTTCATGTCAGTGGATATGC -3'
(R):5'- CCTTCGCAGAGTACACTGGGTAATG -3'

Sequencing Primer
(F):5'- TCAGTGGATATGCTTCAGGGAAATC -3'
(R):5'- GTAATGGTTTTCTTGACCCACAG -3'
Posted On 2013-10-16