Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Iars2'

76703

Institutional Source

Beutler Lab

Gene Symbol

Iars2

Ensembl Gene

ENSMUSG00000026618

Gene Name

isoleucine-tRNA synthetase 2, mitochondrial

Synonyms

2010002H18Rik

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

185284726-185329396 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 185320874 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 400 (E400G)

Ref Sequence

ENSEMBL: ENSMUSP00000106601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000110974] [ENSMUST00000110975]

AlphaFold

Q8BIJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000027921
AA Change: E400G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: E400G

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
Pfam:tRNA-synt_1	87	712	3.6e-172	PFAM
Pfam:tRNA-synt_1g	112	268	7e-15	PFAM
Pfam:tRNA-synt_1_2	334	462	3.8e-7	PFAM
Pfam:Anticodon_1	756	920	1.3e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110974
AA Change: E400G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106601
Gene: ENSMUSG00000026618
AA Change: E400G

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
Pfam:tRNA-synt_1	87	552	2e-130	PFAM
Pfam:tRNA-synt_1g	113	269	2.2e-17	PFAM
Pfam:tRNA-synt_1_2	293	462	9e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110975
AA Change: E400G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106603
Gene: ENSMUSG00000026618
AA Change: E400G

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
Pfam:tRNA-synt_1	87	712	1.2e-171	PFAM
Pfam:tRNA-synt_1g	113	269	3.4e-17	PFAM
Pfam:tRNA-synt_1_2	293	462	1.4e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153211

Meta Mutation Damage Score

0.6975

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Iars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Iars2	APN	1	185315954	missense	probably benign	0.00
IGL00906:Iars2	APN	1	185296403	splice site	probably benign
IGL01287:Iars2	APN	1	185296428	missense	possibly damaging	0.90
IGL01814:Iars2	APN	1	185302775	nonsense	probably null
IGL02016:Iars2	APN	1	185303306	missense	probably damaging	0.99
IGL02995:Iars2	APN	1	185303301	missense	probably benign
IGL03002:Iars2	APN	1	185322816	splice site	probably null
IGL03248:Iars2	APN	1	185291432	unclassified	probably benign
R0304:Iars2	UTSW	1	185287156	missense	possibly damaging	0.77
R0711:Iars2	UTSW	1	185322388	splice site	probably benign
R0990:Iars2	UTSW	1	185318627	missense	probably damaging	1.00
R1867:Iars2	UTSW	1	185318568	missense	probably benign	0.01
R1868:Iars2	UTSW	1	185318568	missense	probably benign	0.01
R1957:Iars2	UTSW	1	185295671	missense	possibly damaging	0.89
R2378:Iars2	UTSW	1	185327721	missense	probably damaging	1.00
R3784:Iars2	UTSW	1	185287131	missense	probably benign	0.17
R4061:Iars2	UTSW	1	185303386	missense	possibly damaging	0.85
R4334:Iars2	UTSW	1	185303394	missense	probably benign	0.35
R4708:Iars2	UTSW	1	185289357	missense	probably benign	0.00
R4723:Iars2	UTSW	1	185315979	missense	probably damaging	1.00
R4729:Iars2	UTSW	1	185316051	missense	possibly damaging	0.71
R4851:Iars2	UTSW	1	185327648	missense	probably damaging	0.99
R5033:Iars2	UTSW	1	185317928	missense	possibly damaging	0.65
R5215:Iars2	UTSW	1	185294769	missense	probably damaging	1.00
R5260:Iars2	UTSW	1	185323734	missense	probably damaging	1.00
R5286:Iars2	UTSW	1	185323121	intron	probably benign
R5614:Iars2	UTSW	1	185289508	missense	probably benign	0.00
R6659:Iars2	UTSW	1	185288076	missense	possibly damaging	0.76
R6838:Iars2	UTSW	1	185329145	missense	probably damaging	0.98
R7057:Iars2	UTSW	1	185289367	missense	probably benign	0.03
R7462:Iars2	UTSW	1	185322866	missense	probably damaging	1.00
R7690:Iars2	UTSW	1	185320997	missense	probably damaging	1.00
R8021:Iars2	UTSW	1	185322457	missense	probably benign	0.05
R8097:Iars2	UTSW	1	185329389	unclassified	probably benign
R8198:Iars2	UTSW	1	185297506	missense	probably benign	0.19
R8283:Iars2	UTSW	1	185288091	nonsense	probably null
R8543:Iars2	UTSW	1	185287144	missense	probably benign	0.00
R8710:Iars2	UTSW	1	185295586	missense	probably benign	0.13
R8713:Iars2	UTSW	1	185291418	missense	possibly damaging	0.58
R8856:Iars2	UTSW	1	185296424	missense	probably benign	0.10
R9206:Iars2	UTSW	1	185317949	missense	possibly damaging	0.83
R9304:Iars2	UTSW	1	185323203	nonsense	probably null
R9435:Iars2	UTSW	1	185302716	missense	probably damaging	1.00
R9634:Iars2	UTSW	1	185295530	makesense	probably null
Z1177:Iars2	UTSW	1	185315895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGCCTTCATGTCAGTGGATATGC -3'
(R):5'- CCTTCGCAGAGTACACTGGGTAATG -3'

Sequencing Primer
(F):5'- TCAGTGGATATGCTTCAGGGAAATC -3'
(R):5'- GTAATGGTTTTCTTGACCCACAG -3'

Posted On

2013-10-16