Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Eprs'

76704

Institutional Source

Beutler Lab

Gene Symbol

Eprs

Ensembl Gene

ENSMUSG00000026615

Gene Name

glutamyl-prolyl-tRNA synthetase

Synonyms

2410081F06Rik, 3010002K18Rik, Qprs

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

185363044-185428360 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 185398458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 672 (L672P)

Ref Sequence

ENSEMBL: ENSMUSP00000045841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046514]

AlphaFold

Q8CGC7

Predicted Effect

probably damaging
Transcript: ENSMUST00000046514
AA Change: L672P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: L672P

Domain	Start	End	E-Value	Type
Pfam:GST_C_3	71	156	2.1e-15	PFAM
Pfam:GST_C	72	157	2.9e-7	PFAM
Pfam:tRNA-synt_1c	197	502	8.8e-127	PFAM
Pfam:tRNA-synt_1c_C	504	681	4.4e-42	PFAM
WHEP-TRS	753	815	1.26e-25	SMART
WHEP-TRS	826	888	1.47e-26	SMART
WHEP-TRS	904	966	3.76e-24	SMART
low complexity region	984	1011	N/A	INTRINSIC
Pfam:tRNA-synt_2b	1107	1287	3.1e-17	PFAM
Pfam:HGTP_anticodon	1303	1404	1.7e-19	PFAM
ProRS-C_1	1430	1512	5.27e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192284

Meta Mutation Damage Score

0.9371

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Eprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00532:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00543:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00553:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00574:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00583:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00946:Eprs	APN	1	185407701	missense	probably benign	0.02
IGL01062:Eprs	APN	1	185379615	missense	probably benign	0.19
IGL01477:Eprs	APN	1	185411375	splice site	probably benign
IGL01608:Eprs	APN	1	185385114	unclassified	probably benign
IGL01767:Eprs	APN	1	185384915	missense	probably damaging	0.98
IGL02136:Eprs	APN	1	185384983	missense	probably damaging	1.00
IGL02302:Eprs	APN	1	185387124	splice site	probably benign
IGL02528:Eprs	APN	1	185413489	missense	probably damaging	1.00
IGL02631:Eprs	APN	1	185427898	missense	probably damaging	1.00
IGL02989:Eprs	APN	1	185418366	missense	probably benign	0.31
IGL03004:Eprs	APN	1	185381833	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0179:Eprs	UTSW	1	185413547	missense	probably benign
R1319:Eprs	UTSW	1	185384962	missense	probably damaging	1.00
R1335:Eprs	UTSW	1	185387089	missense	probably damaging	1.00
R1514:Eprs	UTSW	1	185381834	missense	probably damaging	0.99
R1590:Eprs	UTSW	1	185401510	missense	probably damaging	1.00
R1688:Eprs	UTSW	1	185384896	missense	probably damaging	0.99
R1725:Eprs	UTSW	1	185406992	missense	probably damaging	1.00
R2182:Eprs	UTSW	1	185379742	splice site	probably null
R2228:Eprs	UTSW	1	185367537	missense	probably damaging	1.00
R2336:Eprs	UTSW	1	185411374	splice site	probably benign
R2338:Eprs	UTSW	1	185415808	missense	probably damaging	1.00
R2439:Eprs	UTSW	1	185379742	splice site	probably null
R2914:Eprs	UTSW	1	185379742	splice site	probably null
R3001:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3002:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3003:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3547:Eprs	UTSW	1	185379742	splice site	probably null
R3775:Eprs	UTSW	1	185373008	missense	probably damaging	1.00
R3878:Eprs	UTSW	1	185415953	critical splice donor site	probably null
R3902:Eprs	UTSW	1	185379742	splice site	probably null
R3913:Eprs	UTSW	1	185379742	splice site	probably null
R4579:Eprs	UTSW	1	185401607	missense	probably damaging	1.00
R4664:Eprs	UTSW	1	185373076	intron	probably benign
R4680:Eprs	UTSW	1	185386278	missense	possibly damaging	0.87
R4712:Eprs	UTSW	1	185428108	missense	probably benign	0.00
R4749:Eprs	UTSW	1	185396130	missense	probably damaging	0.97
R4995:Eprs	UTSW	1	185410139	intron	probably benign
R5154:Eprs	UTSW	1	185413465	missense	probably damaging	1.00
R5640:Eprs	UTSW	1	185374184	missense	probably benign	0.34
R5662:Eprs	UTSW	1	185394425	missense	possibly damaging	0.72
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6151:Eprs	UTSW	1	185407754	critical splice donor site	probably null
R6387:Eprs	UTSW	1	185387084	missense	possibly damaging	0.94
R6647:Eprs	UTSW	1	185414424	missense	probably damaging	1.00
R6701:Eprs	UTSW	1	185370890	missense	probably damaging	0.99
R6997:Eprs	UTSW	1	185396163	missense	possibly damaging	0.50
R7295:Eprs	UTSW	1	185418210	critical splice acceptor site	probably null
R7305:Eprs	UTSW	1	185379701	missense	probably damaging	1.00
R7729:Eprs	UTSW	1	185413169	missense	probably damaging	1.00
R7732:Eprs	UTSW	1	185372939	missense	probably benign	0.01
R7733:Eprs	UTSW	1	185397161	missense	probably benign
R7826:Eprs	UTSW	1	185406968	missense	probably damaging	0.96
R7988:Eprs	UTSW	1	185418348	missense	probably damaging	1.00
R8071:Eprs	UTSW	1	185394456	missense	possibly damaging	0.67
R8157:Eprs	UTSW	1	185398394	missense	probably benign	0.21
R8209:Eprs	UTSW	1	185407615	missense	possibly damaging	0.71
R8370:Eprs	UTSW	1	185399257	missense	probably damaging	0.98
R8493:Eprs	UTSW	1	185407174	nonsense	probably null
R8556:Eprs	UTSW	1	185420288	critical splice donor site	probably null
R8877:Eprs	UTSW	1	185415874	nonsense	probably null
R9096:Eprs	UTSW	1	185407106	missense	probably benign	0.03
R9097:Eprs	UTSW	1	185407106	missense	probably benign	0.03
R9112:Eprs	UTSW	1	185397076	missense	probably damaging	1.00
R9189:Eprs	UTSW	1	185374137	missense	possibly damaging	0.89
R9489:Eprs	UTSW	1	185407698	missense	probably benign	0.20
R9489:Eprs	UTSW	1	185407699	missense	probably benign	0.00
R9518:Eprs	UTSW	1	185379566	missense	probably benign	0.00
R9586:Eprs	UTSW	1	185407549	missense

Predicted Primers

PCR Primer
(F):5'- CTTGTGTTTTCAGTGAGCATATTCCAGC -3'
(R):5'- CACGGGTTACTTCCAGCATTTAGGG -3'

Sequencing Primer
(F):5'- AGCTGTTGGAATACTGCTGTG -3'
(R):5'- CTTAGGAGTTACATCCCACGGAG -3'

Posted On

2013-10-16