Mutagenetix > Incidental Mutations

Incidental Mutation 'R0783:Olfr1099'

76707

Institutional Source

Beutler Lab

Gene Symbol

Olfr1099

Ensembl Gene

ENSMUSG00000075168

Gene Name

olfactory receptor 1099

Synonyms

MOR206-3, GA_x6K02T2Q125-48446067-48445129

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86955126-86960693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86958562 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 299 (C299R)

Ref Sequence

ENSEMBL: ENSMUSP00000149528 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099871] [ENSMUST00000213456]

Predicted Effect

probably benign
Transcript: ENSMUST00000099871
AA Change: C299R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097456
Gene: ENSMUSG00000075168
AA Change: C299R

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	5.9e-54	PFAM
Pfam:7tm_1	41	290	1.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213456
AA Change: C299R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Olfr1099

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Olfr1099	APN	2	86958921	missense	possibly damaging	0.90
IGL01624:Olfr1099	APN	2	86959230	missense	probably benign	0.05
IGL02119:Olfr1099	APN	2	86959183	missense	probably benign	0.24
IGL02433:Olfr1099	APN	2	86959048	missense	possibly damaging	0.63
IGL02646:Olfr1099	APN	2	86959353	missense	probably damaging	1.00
IGL02824:Olfr1099	APN	2	86958993	missense	probably benign	0.03
IGL03228:Olfr1099	APN	2	86958706	missense	probably benign	0.16
R0208:Olfr1099	UTSW	2	86959404	missense	probably damaging	0.96
R0521:Olfr1099	UTSW	2	86958846	missense	probably damaging	1.00
R1706:Olfr1099	UTSW	2	86959080	missense	probably damaging	1.00
R1859:Olfr1099	UTSW	2	86959081	missense	probably damaging	0.99
R2046:Olfr1099	UTSW	2	86958733	missense	possibly damaging	0.75
R2126:Olfr1099	UTSW	2	86959098	missense	possibly damaging	0.63
R2140:Olfr1099	UTSW	2	86959281	missense	probably damaging	1.00
R4452:Olfr1099	UTSW	2	86958699	missense	probably damaging	0.99
R4680:Olfr1099	UTSW	2	86959321	missense	possibly damaging	0.87
R4958:Olfr1099	UTSW	2	86959105	missense	possibly damaging	0.75
R4970:Olfr1099	UTSW	2	86959354	missense	probably damaging	1.00
R5112:Olfr1099	UTSW	2	86959354	missense	probably damaging	1.00
R5532:Olfr1099	UTSW	2	86958580	nonsense	probably null
R5691:Olfr1099	UTSW	2	86959272	missense	probably damaging	1.00
R6851:Olfr1099	UTSW	2	86959267	missense	possibly damaging	0.46
R6858:Olfr1099	UTSW	2	86958690	missense	probably benign	0.11
R7368:Olfr1099	UTSW	2	86959258	missense	probably damaging	1.00
Z1088:Olfr1099	UTSW	2	86958666	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACACATTCACTGACAATGTGAATTGCCT -3'
(R):5'- CTCAACTTGTGCCTCTCATATCCTGG -3'

Sequencing Primer
(F):5'- AGTGATTAAATACCCAGTGAACTTTG -3'
(R):5'- GCCTCTCATATCCTGGCAGTTAC -3'

Posted On

2013-10-16