Incidental Mutation 'R0783:Olfr1099'
ID76707
Institutional Source Beutler Lab
Gene Symbol Olfr1099
Ensembl Gene ENSMUSG00000075168
Gene Nameolfactory receptor 1099
SynonymsMOR206-3, GA_x6K02T2Q125-48446067-48445129
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0783 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86955126-86960693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86958562 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 299 (C299R)
Ref Sequence ENSEMBL: ENSMUSP00000149528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099871] [ENSMUST00000213456]
Predicted Effect probably benign
Transcript: ENSMUST00000099871
AA Change: C299R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097456
Gene: ENSMUSG00000075168
AA Change: C299R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.9e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213456
AA Change: C299R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Olfr1099
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Olfr1099 APN 2 86958921 missense possibly damaging 0.90
IGL01624:Olfr1099 APN 2 86959230 missense probably benign 0.05
IGL02119:Olfr1099 APN 2 86959183 missense probably benign 0.24
IGL02433:Olfr1099 APN 2 86959048 missense possibly damaging 0.63
IGL02646:Olfr1099 APN 2 86959353 missense probably damaging 1.00
IGL02824:Olfr1099 APN 2 86958993 missense probably benign 0.03
IGL03228:Olfr1099 APN 2 86958706 missense probably benign 0.16
R0208:Olfr1099 UTSW 2 86959404 missense probably damaging 0.96
R0521:Olfr1099 UTSW 2 86958846 missense probably damaging 1.00
R1706:Olfr1099 UTSW 2 86959080 missense probably damaging 1.00
R1859:Olfr1099 UTSW 2 86959081 missense probably damaging 0.99
R2046:Olfr1099 UTSW 2 86958733 missense possibly damaging 0.75
R2126:Olfr1099 UTSW 2 86959098 missense possibly damaging 0.63
R2140:Olfr1099 UTSW 2 86959281 missense probably damaging 1.00
R4452:Olfr1099 UTSW 2 86958699 missense probably damaging 0.99
R4680:Olfr1099 UTSW 2 86959321 missense possibly damaging 0.87
R4958:Olfr1099 UTSW 2 86959105 missense possibly damaging 0.75
R4970:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5112:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5532:Olfr1099 UTSW 2 86958580 nonsense probably null
R5691:Olfr1099 UTSW 2 86959272 missense probably damaging 1.00
R6851:Olfr1099 UTSW 2 86959267 missense possibly damaging 0.46
R6858:Olfr1099 UTSW 2 86958690 missense probably benign 0.11
R7368:Olfr1099 UTSW 2 86959258 missense probably damaging 1.00
Z1088:Olfr1099 UTSW 2 86958666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACATTCACTGACAATGTGAATTGCCT -3'
(R):5'- CTCAACTTGTGCCTCTCATATCCTGG -3'

Sequencing Primer
(F):5'- AGTGATTAAATACCCAGTGAACTTTG -3'
(R):5'- GCCTCTCATATCCTGGCAGTTAC -3'
Posted On2013-10-16