Incidental Mutation 'R0783:Olfr1224-ps1'
ID 76708
Institutional Source Beutler Lab
Gene Symbol Olfr1224-ps1
Ensembl Gene ENSMUSG00000075099
Gene Name olfactory receptor 1224, pseudogene 1
Synonyms GA_x6K02T2Q125-50635980-50635046, MOR233-15
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89155336-89164091 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89156891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 95 (C95S)
Ref Sequence ENSEMBL: ENSMUSP00000148938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099792] [ENSMUST00000099793] [ENSMUST00000216833] [ENSMUST00000216976]
AlphaFold A3KGY4
Predicted Effect probably benign
Transcript: ENSMUST00000099792
AA Change: C95S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097380
Gene: ENSMUSG00000075099
AA Change: C95S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-48 PFAM
Pfam:7tm_1 39 287 9.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099793
AA Change: C95S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097381
Gene: ENSMUSG00000075099
AA Change: C95S

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2e-26 PFAM
Pfam:7tm_4 138 283 5.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214069
Predicted Effect probably benign
Transcript: ENSMUST00000216833
AA Change: C95S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216913
Predicted Effect probably benign
Transcript: ENSMUST00000216976
AA Change: C95S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Olfr1224-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Olfr1224-ps1 APN 2 89156917 missense probably benign 0.01
IGL02561:Olfr1224-ps1 APN 2 89157141 missense possibly damaging 0.94
R0086:Olfr1224-ps1 UTSW 2 89156476 missense probably benign 0.01
R0096:Olfr1224-ps1 UTSW 2 89156296 missense probably benign 0.03
R0096:Olfr1224-ps1 UTSW 2 89156296 missense probably benign 0.03
R1920:Olfr1224-ps1 UTSW 2 89156581 missense probably benign 0.44
R1921:Olfr1224-ps1 UTSW 2 89156581 missense probably benign 0.44
R2033:Olfr1224-ps1 UTSW 2 89157154 missense probably damaging 0.96
R3500:Olfr1224-ps1 UTSW 2 89157059 missense probably damaging 1.00
R5044:Olfr1224-ps1 UTSW 2 89156939 nonsense probably null
R5140:Olfr1224-ps1 UTSW 2 89157107 missense probably benign 0.12
R5253:Olfr1224-ps1 UTSW 2 89156457 nonsense probably null
R6338:Olfr1224-ps1 UTSW 2 89156371 missense probably damaging 1.00
R6431:Olfr1224-ps1 UTSW 2 89157161 missense probably damaging 1.00
R6904:Olfr1224-ps1 UTSW 2 89156813 missense possibly damaging 0.57
R7259:Olfr1224-ps1 UTSW 2 89156510 missense probably benign 0.03
R7820:Olfr1224-ps1 UTSW 2 89156248 missense probably benign 0.08
R9026:Olfr1224-ps1 UTSW 2 89156644 missense probably benign 0.22
R9076:Olfr1224-ps1 UTSW 2 89156375 missense possibly damaging 0.95
R9266:Olfr1224-ps1 UTSW 2 89156510 missense possibly damaging 0.70
R9378:Olfr1224-ps1 UTSW 2 89157055 missense probably damaging 1.00
R9580:Olfr1224-ps1 UTSW 2 89157121 missense probably benign 0.20
R9751:Olfr1224-ps1 UTSW 2 89156438 missense possibly damaging 0.91
Z1176:Olfr1224-ps1 UTSW 2 89156467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCTATTCCGACTAGGATGCCAC -3'
(R):5'- GCAAAACCAGAGCATTGTCACTGAG -3'

Sequencing Primer
(F):5'- TAGGATGCCACAGAGCCTC -3'
(R):5'- TGCTGGGACTTTCACAGAAC -3'
Posted On 2013-10-16