Incidental Mutation 'R0783:Serinc3'
ID 76711
Institutional Source Beutler Lab
Gene Symbol Serinc3
Ensembl Gene ENSMUSG00000017707
Gene Name serine incorporator 3
Synonyms AIGP1, DIFF33, TMS-1, Tde1
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 163623272-163645131 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 163637003 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 68 (I68T)
Ref Sequence ENSEMBL: ENSMUSP00000017851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017851]
AlphaFold Q9QZI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000017851
AA Change: I68T

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017851
Gene: ENSMUSG00000017707
AA Change: I68T

DomainStartEndE-ValueType
Pfam:Serinc 16 470 9e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129854
Meta Mutation Damage Score 0.4218 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Serinc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Serinc3 APN 2 163628001 missense probably damaging 1.00
IGL01152:Serinc3 APN 2 163636911 missense probably damaging 0.99
IGL02879:Serinc3 APN 2 163632252 splice site probably benign
IGL02945:Serinc3 APN 2 163630916 splice site probably benign
R1181:Serinc3 UTSW 2 163625526 missense probably damaging 1.00
R1848:Serinc3 UTSW 2 163645489 unclassified probably benign
R4254:Serinc3 UTSW 2 163636968 missense probably benign
R6225:Serinc3 UTSW 2 163627879 missense probably damaging 1.00
R6271:Serinc3 UTSW 2 163630976 missense probably benign 0.15
R6860:Serinc3 UTSW 2 163634446 missense probably benign
R6986:Serinc3 UTSW 2 163627971 missense probably benign 0.00
R7060:Serinc3 UTSW 2 163636959 missense probably benign 0.01
R7618:Serinc3 UTSW 2 163630969 missense possibly damaging 0.88
R9223:Serinc3 UTSW 2 163636892 missense probably benign 0.26
R9274:Serinc3 UTSW 2 163626451 missense probably damaging 1.00
R9766:Serinc3 UTSW 2 163629175 missense probably damaging 1.00
T0970:Serinc3 UTSW 2 163627915 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGAGGGAGAGGAACCACA -3'
(R):5'- AGGAAGGCTGGTGGCCCAA -3'

Sequencing Primer
(F):5'- GACAATCTCACATACCCGTTG -3'
(R):5'- gtcatcttacttcagcctccc -3'
Posted On 2013-10-16