Incidental Mutation 'R0783:Nhlrc3'
ID 76712
Institutional Source Beutler Lab
Gene Symbol Nhlrc3
Ensembl Gene ENSMUSG00000042997
Gene Name NHL repeat containing 3
Synonyms
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 53448583-53463332 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53462449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 34 (S34T)
Ref Sequence ENSEMBL: ENSMUSP00000114215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056749] [ENSMUST00000058577] [ENSMUST00000130348]
AlphaFold Q8CCH2
Predicted Effect probably benign
Transcript: ENSMUST00000056749
AA Change: S34T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055295
Gene: ENSMUSG00000042997
AA Change: S34T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:NHL 213 240 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058577
SMART Domains Protein: ENSMUSP00000055253
Gene: ENSMUSG00000049504

DomainStartEndE-ValueType
Pfam:DUF4476 1 63 5e-12 PFAM
Pfam:DUF4476 30 121 4e-27 PFAM
low complexity region 227 246 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 696 718 N/A INTRINSIC
low complexity region 781 804 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 820 834 N/A INTRINSIC
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129497
Predicted Effect probably benign
Transcript: ENSMUST00000130348
AA Change: S34T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114215
Gene: ENSMUSG00000042997
AA Change: S34T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198983
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing NCL-1, HT2A and Lin-41 (NHL) family repeats. Mammalian NHL-repeat containing proteins may be involved in a variety of enzymatic processes, including protein modification through ubiquitination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Nhlrc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Nhlrc3 APN 3 53453537 splice site probably benign
IGL03113:Nhlrc3 APN 3 53458563 missense possibly damaging 0.86
PIT1430001:Nhlrc3 UTSW 3 53453629 missense probably damaging 1.00
R0486:Nhlrc3 UTSW 3 53452437 missense probably damaging 1.00
R0617:Nhlrc3 UTSW 3 53458623 missense probably damaging 1.00
R1423:Nhlrc3 UTSW 3 53462415 missense probably damaging 1.00
R1606:Nhlrc3 UTSW 3 53458657 nonsense probably null
R2105:Nhlrc3 UTSW 3 53453651 missense probably damaging 1.00
R2214:Nhlrc3 UTSW 3 53456454 missense probably damaging 1.00
R3802:Nhlrc3 UTSW 3 53458631 missense possibly damaging 0.68
R3804:Nhlrc3 UTSW 3 53458631 missense possibly damaging 0.68
R4656:Nhlrc3 UTSW 3 53463080 missense probably damaging 0.99
R4780:Nhlrc3 UTSW 3 53458567 missense probably benign 0.23
R5608:Nhlrc3 UTSW 3 53462311 critical splice donor site probably null
R6298:Nhlrc3 UTSW 3 53452523 missense possibly damaging 0.74
R6810:Nhlrc3 UTSW 3 53453575 missense probably benign 0.02
R7899:Nhlrc3 UTSW 3 53461659 missense probably benign 0.01
R7975:Nhlrc3 UTSW 3 53453545 missense probably damaging 1.00
R9028:Nhlrc3 UTSW 3 53453571 nonsense probably null
R9375:Nhlrc3 UTSW 3 53461769 missense possibly damaging 0.56
R9385:Nhlrc3 UTSW 3 53453594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGATAACCGCATTAACACTCTGGTCTC -3'
(R):5'- GCTGACGACTCGTCCTCTCATTTAG -3'

Sequencing Primer
(F):5'- cttgacctcacaggctcac -3'
(R):5'- gctcactctctcactgtaactc -3'
Posted On 2013-10-16