Incidental Mutation 'R0783:Pcsk9'
ID 76713
Institutional Source Beutler Lab
Gene Symbol Pcsk9
Ensembl Gene ENSMUSG00000044254
Gene Name proprotein convertase subtilisin/kexin type 9
Synonyms Narc1
MMRRC Submission 038963-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 106299531-106321522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106307314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 310 (T310A)
Ref Sequence ENSEMBL: ENSMUSP00000055757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049507]
AlphaFold Q80W65
Predicted Effect probably benign
Transcript: ENSMUST00000049507
AA Change: T310A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254
AA Change: T310A

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Peptidase_S8 180 438 3.1e-34 PFAM
low complexity region 471 481 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an autocatalytic processing event with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. It is expressed in liver, intestine and kidney tissues and escorts specific receptors for lysosomal degradation. It plays a role in cholesterol and fatty acid metabolism. Mutations in this gene have been associated with autosomal dominant familial hypercholesterolemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice exhibit increased clearance of circulating cholesterol and decreased plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,893,380 (GRCm39) G1277R probably damaging Het
Abi3bp A G 16: 56,415,601 (GRCm39) probably null Het
Acsm2 G A 7: 119,172,340 (GRCm39) G61D probably damaging Het
Akp3 G A 1: 87,055,593 (GRCm39) G547R unknown Het
Bbs9 T C 9: 22,479,010 (GRCm39) L151S possibly damaging Het
Camk2g T A 14: 20,794,704 (GRCm39) T173S possibly damaging Het
Eif3b T C 5: 140,405,592 (GRCm39) probably benign Het
Eif3i A C 4: 129,485,869 (GRCm39) F319V possibly damaging Het
Eprs1 T C 1: 185,130,655 (GRCm39) L672P probably damaging Het
Fam110d G A 4: 133,979,368 (GRCm39) R37C probably damaging Het
Fras1 C T 5: 96,916,289 (GRCm39) A3441V probably damaging Het
Gigyf2 T A 1: 87,334,883 (GRCm39) M79K probably damaging Het
Hdac1 T C 4: 129,411,902 (GRCm39) N331S probably benign Het
Hmcn1 C T 1: 150,525,824 (GRCm39) G3300S probably damaging Het
Iars2 T C 1: 185,053,071 (GRCm39) E400G probably damaging Het
Irx2 T C 13: 72,780,769 (GRCm39) probably null Het
Itih4 G A 14: 30,617,380 (GRCm39) E567K possibly damaging Het
Klhl5 T A 5: 65,313,596 (GRCm39) probably benign Het
Klk1b8 G A 7: 43,451,621 (GRCm39) G204E probably damaging Het
Loxhd1 T C 18: 77,517,680 (GRCm39) F1843L possibly damaging Het
Mllt6 T C 11: 97,556,571 (GRCm39) V87A probably damaging Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Nhlrc3 A T 3: 53,369,870 (GRCm39) S34T probably benign Het
Or10q1 T C 19: 13,727,040 (GRCm39) L190P probably damaging Het
Or4c119 A T 2: 88,987,235 (GRCm39) C95S probably benign Het
Or52b3 A G 7: 102,203,646 (GRCm39) I52V probably benign Het
Or52s1 T C 7: 102,861,877 (GRCm39) F259S probably damaging Het
Or5h25 A T 16: 58,930,532 (GRCm39) L147* probably null Het
Or8h9 A G 2: 86,788,906 (GRCm39) C299R probably benign Het
Pcnx4 T C 12: 72,622,252 (GRCm39) W1074R probably damaging Het
Pfas A G 11: 68,891,347 (GRCm39) L250P probably damaging Het
Plk5 T A 10: 80,196,964 (GRCm39) D352E probably benign Het
Ryr3 A G 2: 112,586,672 (GRCm39) probably benign Het
Serinc3 A G 2: 163,478,923 (GRCm39) I68T possibly damaging Het
Sez6l2 A G 7: 126,566,317 (GRCm39) T810A possibly damaging Het
Tmprss7 G A 16: 45,487,969 (GRCm39) Q487* probably null Het
Tnf A G 17: 35,420,650 (GRCm39) I56T probably damaging Het
Ttbk2 A T 2: 120,570,458 (GRCm39) S1163T possibly damaging Het
Ttn G A 2: 76,573,874 (GRCm39) T23927I probably damaging Het
Urb1 G A 16: 90,607,185 (GRCm39) A15V possibly damaging Het
Zfp128 C T 7: 12,624,199 (GRCm39) P189L probably damaging Het
Zfr T C 15: 12,162,268 (GRCm39) V806A probably damaging Het
Other mutations in Pcsk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Pcsk9 APN 4 106,311,843 (GRCm39) missense probably benign 0.00
IGL02709:Pcsk9 APN 4 106,304,886 (GRCm39) splice site probably benign
IGL02804:Pcsk9 APN 4 106,314,161 (GRCm39) missense probably damaging 1.00
IGL02850:Pcsk9 APN 4 106,316,062 (GRCm39) missense probably damaging 1.00
IGL03009:Pcsk9 APN 4 106,311,542 (GRCm39) missense probably damaging 1.00
IGL03294:Pcsk9 APN 4 106,303,967 (GRCm39) missense probably benign
R0271:Pcsk9 UTSW 4 106,306,246 (GRCm39) splice site probably benign
R0321:Pcsk9 UTSW 4 106,301,891 (GRCm39) missense probably benign
R0413:Pcsk9 UTSW 4 106,311,538 (GRCm39) missense probably damaging 1.00
R0426:Pcsk9 UTSW 4 106,307,274 (GRCm39) missense possibly damaging 0.77
R2136:Pcsk9 UTSW 4 106,303,967 (GRCm39) missense probably benign 0.00
R4056:Pcsk9 UTSW 4 106,301,899 (GRCm39) missense probably benign 0.02
R4438:Pcsk9 UTSW 4 106,316,156 (GRCm39) missense probably benign 0.00
R4683:Pcsk9 UTSW 4 106,316,092 (GRCm39) missense possibly damaging 0.59
R4739:Pcsk9 UTSW 4 106,304,353 (GRCm39) missense probably damaging 1.00
R4801:Pcsk9 UTSW 4 106,304,766 (GRCm39) missense probably benign 0.43
R4802:Pcsk9 UTSW 4 106,304,766 (GRCm39) missense probably benign 0.43
R5249:Pcsk9 UTSW 4 106,320,950 (GRCm39) missense probably benign 0.01
R5307:Pcsk9 UTSW 4 106,304,371 (GRCm39) missense probably damaging 1.00
R5320:Pcsk9 UTSW 4 106,320,988 (GRCm39) missense probably benign 0.00
R5653:Pcsk9 UTSW 4 106,316,113 (GRCm39) missense probably damaging 1.00
R5827:Pcsk9 UTSW 4 106,306,144 (GRCm39) missense probably damaging 1.00
R6010:Pcsk9 UTSW 4 106,311,469 (GRCm39) missense possibly damaging 0.92
R6019:Pcsk9 UTSW 4 106,314,073 (GRCm39) missense probably benign 0.02
R6393:Pcsk9 UTSW 4 106,304,793 (GRCm39) missense probably benign 0.00
R7472:Pcsk9 UTSW 4 106,316,094 (GRCm39) missense probably benign 0.08
R7614:Pcsk9 UTSW 4 106,304,763 (GRCm39) missense probably benign 0.34
R7807:Pcsk9 UTSW 4 106,321,092 (GRCm39) missense possibly damaging 0.73
R8036:Pcsk9 UTSW 4 106,311,536 (GRCm39) missense possibly damaging 0.88
R8735:Pcsk9 UTSW 4 106,311,808 (GRCm39) missense probably damaging 1.00
R9258:Pcsk9 UTSW 4 106,316,047 (GRCm39) missense possibly damaging 0.63
R9404:Pcsk9 UTSW 4 106,311,723 (GRCm39) missense probably damaging 1.00
R9684:Pcsk9 UTSW 4 106,307,386 (GRCm39) missense probably benign 0.29
Z1176:Pcsk9 UTSW 4 106,316,138 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTCACAGCTTCCCACAGACATTG -3'
(R):5'- TCTAGTTCTGGGGAACACTCAGCTC -3'

Sequencing Primer
(F):5'- TTCCCACAGACATTGGAATGG -3'
(R):5'- ggcagcaatcagataggttaag -3'
Posted On 2013-10-16