Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Pcsk9'

76713

Institutional Source

Beutler Lab

Gene Symbol

Pcsk9

Ensembl Gene

ENSMUSG00000044254

Gene Name

proprotein convertase subtilisin/kexin type 9

Synonyms

Narc1

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106442329-106464329 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106450117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 310 (T310A)

Ref Sequence

ENSEMBL: ENSMUSP00000055757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049507]

AlphaFold

Q80W65

Predicted Effect

probably benign
Transcript: ENSMUST00000049507
AA Change: T310A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254
AA Change: T310A

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Peptidase_S8	180	438	3.1e-34	PFAM
low complexity region	471	481	N/A	INTRINSIC
low complexity region	490	500	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an autocatalytic processing event with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. It is expressed in liver, intestine and kidney tissues and escorts specific receptors for lysosomal degradation. It plays a role in cholesterol and fatty acid metabolism. Mutations in this gene have been associated with autosomal dominant familial hypercholesterolemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice exhibit increased clearance of circulating cholesterol and decreased plasma cholesterol levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Pcsk9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02140:Pcsk9	APN	4	106454646	missense	probably benign	0.00
IGL02709:Pcsk9	APN	4	106447689	splice site	probably benign
IGL02804:Pcsk9	APN	4	106456964	missense	probably damaging	1.00
IGL02850:Pcsk9	APN	4	106458865	missense	probably damaging	1.00
IGL03009:Pcsk9	APN	4	106454345	missense	probably damaging	1.00
IGL03294:Pcsk9	APN	4	106446770	missense	probably benign
R0271:Pcsk9	UTSW	4	106449049	splice site	probably benign
R0321:Pcsk9	UTSW	4	106444694	missense	probably benign
R0413:Pcsk9	UTSW	4	106454341	missense	probably damaging	1.00
R0426:Pcsk9	UTSW	4	106450077	missense	possibly damaging	0.77
R2136:Pcsk9	UTSW	4	106446770	missense	probably benign	0.00
R4056:Pcsk9	UTSW	4	106444702	missense	probably benign	0.02
R4438:Pcsk9	UTSW	4	106458959	missense	probably benign	0.00
R4683:Pcsk9	UTSW	4	106458895	missense	possibly damaging	0.59
R4739:Pcsk9	UTSW	4	106447156	missense	probably damaging	1.00
R4801:Pcsk9	UTSW	4	106447569	missense	probably benign	0.43
R4802:Pcsk9	UTSW	4	106447569	missense	probably benign	0.43
R5249:Pcsk9	UTSW	4	106463753	missense	probably benign	0.01
R5307:Pcsk9	UTSW	4	106447174	missense	probably damaging	1.00
R5320:Pcsk9	UTSW	4	106463791	missense	probably benign	0.00
R5653:Pcsk9	UTSW	4	106458916	missense	probably damaging	1.00
R5827:Pcsk9	UTSW	4	106448947	missense	probably damaging	1.00
R6010:Pcsk9	UTSW	4	106454272	missense	possibly damaging	0.92
R6019:Pcsk9	UTSW	4	106456876	missense	probably benign	0.02
R6393:Pcsk9	UTSW	4	106447596	missense	probably benign	0.00
R7472:Pcsk9	UTSW	4	106458897	missense	probably benign	0.08
R7614:Pcsk9	UTSW	4	106447566	missense	probably benign	0.34
R7807:Pcsk9	UTSW	4	106463895	missense	possibly damaging	0.73
R8036:Pcsk9	UTSW	4	106454339	missense	possibly damaging	0.88
R8735:Pcsk9	UTSW	4	106454611	missense	probably damaging	1.00
R9258:Pcsk9	UTSW	4	106458850	missense	possibly damaging	0.63
R9404:Pcsk9	UTSW	4	106454526	missense	probably damaging	1.00
R9684:Pcsk9	UTSW	4	106450189	missense	probably benign	0.29
Z1176:Pcsk9	UTSW	4	106458941	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGTCACAGCTTCCCACAGACATTG -3'
(R):5'- TCTAGTTCTGGGGAACACTCAGCTC -3'

Sequencing Primer
(F):5'- TTCCCACAGACATTGGAATGG -3'
(R):5'- ggcagcaatcagataggttaag -3'

Posted On

2013-10-16