Incidental Mutation 'R0783:Eif3i'
ID 76715
Institutional Source Beutler Lab
Gene Symbol Eif3i
Ensembl Gene ENSMUSG00000028798
Gene Name eukaryotic translation initiation factor 3, subunit I
Synonyms Eif3s2, 36kDa, TRIP-1, D4Ertd632e
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 129591960-129600648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 129592076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 319 (F319V)
Ref Sequence ENSEMBL: ENSMUSP00000099653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102593] [ENSMUST00000135055]
AlphaFold Q9QZD9
Predicted Effect possibly damaging
Transcript: ENSMUST00000102593
AA Change: F319V

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099653
Gene: ENSMUSG00000028798
AA Change: F319V

DomainStartEndE-ValueType
WD40 1 38 1.1e1 SMART
WD40 41 80 1.07e-8 SMART
WD40 135 174 3.84e0 SMART
WD40 177 216 6.63e-5 SMART
Blast:WD40 219 257 2e-18 BLAST
WD40 274 313 3.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135055
SMART Domains Protein: ENSMUSP00000120776
Gene: ENSMUSG00000028798

DomainStartEndE-ValueType
WD40 2 32 1.54e0 SMART
Blast:WD40 35 78 1e-9 BLAST
WD40 87 126 3.84e0 SMART
WD40 129 163 8.25e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155428
Meta Mutation Damage Score 0.4935 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Eif3i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Eif3i APN 4 129595069 missense probably benign
IGL02222:Eif3i APN 4 129592088 missense possibly damaging 0.89
IGL02975:Eif3i APN 4 129595312 missense probably damaging 0.99
R0683:Eif3i UTSW 4 129593535 missense probably benign 0.12
R0920:Eif3i UTSW 4 129595257 splice site probably benign
R1251:Eif3i UTSW 4 129593385 missense probably damaging 1.00
R2132:Eif3i UTSW 4 129596926 missense probably benign 0.02
R2133:Eif3i UTSW 4 129596926 missense probably benign 0.02
R3978:Eif3i UTSW 4 129592336 missense probably damaging 1.00
R4781:Eif3i UTSW 4 129595273 missense probably benign 0.11
R4808:Eif3i UTSW 4 129592064 missense probably benign 0.15
R5096:Eif3i UTSW 4 129600444 missense probably damaging 0.97
R5335:Eif3i UTSW 4 129595186 missense probably benign 0.20
R6048:Eif3i UTSW 4 129593352 missense probably benign 0.01
R7087:Eif3i UTSW 4 129592311 missense probably damaging 1.00
R7503:Eif3i UTSW 4 129600414 missense probably damaging 0.97
R8798:Eif3i UTSW 4 129596924 missense probably benign 0.00
R9652:Eif3i UTSW 4 129595301 missense probably benign
RF012:Eif3i UTSW 4 129592079 missense probably damaging 1.00
RF019:Eif3i UTSW 4 129600465 missense probably damaging 1.00
Z1176:Eif3i UTSW 4 129600575 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTAGGCACTGGCTTCTTGAATG -3'
(R):5'- AAGAGTCAAGGGCCACTTTGGACC -3'

Sequencing Primer
(F):5'- CTCTTGGATGAAGGTGTCTACAAC -3'
(R):5'- TTCCATCCTGATGGCAAGAG -3'
Posted On 2013-10-16