Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Klhl5'

76717

Institutional Source

Beutler Lab

Gene Symbol

Klhl5

Ensembl Gene

ENSMUSG00000054920

Gene Name

kelch-like 5

Synonyms

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65107539-65168188 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 65156253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101191] [ENSMUST00000203538] [ENSMUST00000204097] [ENSMUST00000204348]

AlphaFold

Q6PFE1

Predicted Effect

probably benign
Transcript: ENSMUST00000101191

SMART Domains

Protein: ENSMUSP00000098752
Gene: ENSMUSG00000054920

Domain	Start	End	E-Value	Type
low complexity region	114	137	N/A	INTRINSIC
BTB	173	270	1.5e-28	SMART
BACK	275	376	7.85e-36	SMART
Kelch	421	467	1.12e-11	SMART
Kelch	468	514	3.2e-16	SMART
Kelch	515	561	1.51e-12	SMART
Kelch	562	608	4.6e-17	SMART
Kelch	609	661	2.84e-8	SMART
Kelch	662	708	1.83e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203538

SMART Domains

Protein: ENSMUSP00000145269
Gene: ENSMUSG00000054920

Domain	Start	End	E-Value	Type
Kelch	46	92	3.7e-14	SMART
Kelch	93	139	1.1e-18	SMART
Kelch	140	186	5.1e-15	SMART
Kelch	187	233	1.5e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203561

Predicted Effect

probably benign
Transcript: ENSMUST00000204097

SMART Domains

Protein: ENSMUSP00000144976
Gene: ENSMUSG00000054920

Domain	Start	End	E-Value	Type
BTB	33	130	1.5e-28	SMART
BACK	135	236	7.85e-36	SMART
Kelch	281	327	1.12e-11	SMART
Kelch	328	374	3.2e-16	SMART
Kelch	375	421	1.51e-12	SMART
Kelch	422	468	4.6e-17	SMART
Kelch	469	521	2.84e-8	SMART
Kelch	522	568	1.83e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204348

SMART Domains

Protein: ENSMUSP00000144732
Gene: ENSMUSG00000054920

Domain	Start	End	E-Value	Type
BTB	111	209	1.32e-15	SMART
BACK	214	315	7.85e-36	SMART
Kelch	360	406	1.12e-11	SMART
Kelch	407	453	3.2e-16	SMART
Kelch	454	500	1.51e-12	SMART
Kelch	501	547	4.6e-17	SMART
Kelch	548	600	2.84e-8	SMART
Kelch	601	647	1.83e-11	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Klhl5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02152:Klhl5	APN	5	65148800	missense	probably damaging	0.98
IGL02700:Klhl5	APN	5	65131430	nonsense	probably null
R0064:Klhl5	UTSW	5	65141288	missense	probably benign	0.13
R0142:Klhl5	UTSW	5	65143350	nonsense	probably null
R0828:Klhl5	UTSW	5	65162792	missense	probably damaging	1.00
R1160:Klhl5	UTSW	5	65141340	missense	probably benign	0.13
R1181:Klhl5	UTSW	5	65162885	missense	probably damaging	0.99
R1611:Klhl5	UTSW	5	65164649	missense	probably benign	0.00
R1903:Klhl5	UTSW	5	65166987	missense	probably benign	0.37
R4880:Klhl5	UTSW	5	65158901	missense	probably damaging	1.00
R4961:Klhl5	UTSW	5	65152690	intron	probably benign
R5204:Klhl5	UTSW	5	65131438	missense	possibly damaging	0.95
R5389:Klhl5	UTSW	5	65141282	missense	possibly damaging	0.76
R5921:Klhl5	UTSW	5	65162956	missense	probably damaging	0.96
R6769:Klhl5	UTSW	5	65164652	missense	probably damaging	1.00
R6771:Klhl5	UTSW	5	65164652	missense	probably damaging	1.00
R7008:Klhl5	UTSW	5	65143249	missense	probably benign	0.02
R7214:Klhl5	UTSW	5	65131755	missense	probably benign
R7227:Klhl5	UTSW	5	65141288	missense	probably benign	0.00
R7239:Klhl5	UTSW	5	65161186	missense	probably damaging	1.00
R7400:Klhl5	UTSW	5	65148590	missense	possibly damaging	0.81
R7796:Klhl5	UTSW	5	65164622	missense	probably damaging	1.00
R8081:Klhl5	UTSW	5	65162925	missense	possibly damaging	0.94
R8108:Klhl5	UTSW	5	65148587	critical splice acceptor site	probably null
R8185:Klhl5	UTSW	5	65156128	missense	probably damaging	0.99
R8424:Klhl5	UTSW	5	65162962	missense	probably benign	0.10
R8691:Klhl5	UTSW	5	65149538	intron	probably benign
R8818:Klhl5	UTSW	5	65148646	missense	probably benign	0.23
R9233:Klhl5	UTSW	5	65143330	missense	possibly damaging	0.95
R9456:Klhl5	UTSW	5	65148596	missense	probably damaging	1.00
R9528:Klhl5	UTSW	5	65156243	critical splice donor site	probably null
R9688:Klhl5	UTSW	5	65164587	missense	probably damaging	1.00
R9744:Klhl5	UTSW	5	65162912	missense	probably damaging	1.00
X0009:Klhl5	UTSW	5	65162921	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CTGGCAGACATGGAAAACAATGCAC -3'
(R):5'- CCTCTAGGAACAACTGTTCACAGAATCC -3'

Sequencing Primer
(F):5'- GGAAAACAATGCACTTTTCCG -3'
(R):5'- gctttcctttccatctgtgtc -3'

Posted On

2013-10-16