Incidental Mutation 'R0783:Klhl5'
ID 76717
Institutional Source Beutler Lab
Gene Symbol Klhl5
Ensembl Gene ENSMUSG00000054920
Gene Name kelch-like 5
Synonyms
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 65107539-65168188 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 65156253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101191] [ENSMUST00000203538] [ENSMUST00000204097] [ENSMUST00000204348]
AlphaFold Q6PFE1
Predicted Effect probably benign
Transcript: ENSMUST00000101191
SMART Domains Protein: ENSMUSP00000098752
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
low complexity region 114 137 N/A INTRINSIC
BTB 173 270 1.5e-28 SMART
BACK 275 376 7.85e-36 SMART
Kelch 421 467 1.12e-11 SMART
Kelch 468 514 3.2e-16 SMART
Kelch 515 561 1.51e-12 SMART
Kelch 562 608 4.6e-17 SMART
Kelch 609 661 2.84e-8 SMART
Kelch 662 708 1.83e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203538
SMART Domains Protein: ENSMUSP00000145269
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
Kelch 46 92 3.7e-14 SMART
Kelch 93 139 1.1e-18 SMART
Kelch 140 186 5.1e-15 SMART
Kelch 187 233 1.5e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203561
Predicted Effect probably benign
Transcript: ENSMUST00000204097
SMART Domains Protein: ENSMUSP00000144976
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
BTB 33 130 1.5e-28 SMART
BACK 135 236 7.85e-36 SMART
Kelch 281 327 1.12e-11 SMART
Kelch 328 374 3.2e-16 SMART
Kelch 375 421 1.51e-12 SMART
Kelch 422 468 4.6e-17 SMART
Kelch 469 521 2.84e-8 SMART
Kelch 522 568 1.83e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204348
SMART Domains Protein: ENSMUSP00000144732
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
BTB 111 209 1.32e-15 SMART
BACK 214 315 7.85e-36 SMART
Kelch 360 406 1.12e-11 SMART
Kelch 407 453 3.2e-16 SMART
Kelch 454 500 1.51e-12 SMART
Kelch 501 547 4.6e-17 SMART
Kelch 548 600 2.84e-8 SMART
Kelch 601 647 1.83e-11 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Klhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Klhl5 APN 5 65148800 missense probably damaging 0.98
IGL02700:Klhl5 APN 5 65131430 nonsense probably null
R0064:Klhl5 UTSW 5 65141288 missense probably benign 0.13
R0142:Klhl5 UTSW 5 65143350 nonsense probably null
R0828:Klhl5 UTSW 5 65162792 missense probably damaging 1.00
R1160:Klhl5 UTSW 5 65141340 missense probably benign 0.13
R1181:Klhl5 UTSW 5 65162885 missense probably damaging 0.99
R1611:Klhl5 UTSW 5 65164649 missense probably benign 0.00
R1903:Klhl5 UTSW 5 65166987 missense probably benign 0.37
R4880:Klhl5 UTSW 5 65158901 missense probably damaging 1.00
R4961:Klhl5 UTSW 5 65152690 intron probably benign
R5204:Klhl5 UTSW 5 65131438 missense possibly damaging 0.95
R5389:Klhl5 UTSW 5 65141282 missense possibly damaging 0.76
R5921:Klhl5 UTSW 5 65162956 missense probably damaging 0.96
R6769:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R6771:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R7008:Klhl5 UTSW 5 65143249 missense probably benign 0.02
R7214:Klhl5 UTSW 5 65131755 missense probably benign
R7227:Klhl5 UTSW 5 65141288 missense probably benign 0.00
R7239:Klhl5 UTSW 5 65161186 missense probably damaging 1.00
R7400:Klhl5 UTSW 5 65148590 missense possibly damaging 0.81
R7796:Klhl5 UTSW 5 65164622 missense probably damaging 1.00
R8081:Klhl5 UTSW 5 65162925 missense possibly damaging 0.94
R8108:Klhl5 UTSW 5 65148587 critical splice acceptor site probably null
R8185:Klhl5 UTSW 5 65156128 missense probably damaging 0.99
R8424:Klhl5 UTSW 5 65162962 missense probably benign 0.10
R8691:Klhl5 UTSW 5 65149538 intron probably benign
R8818:Klhl5 UTSW 5 65148646 missense probably benign 0.23
R9233:Klhl5 UTSW 5 65143330 missense possibly damaging 0.95
R9456:Klhl5 UTSW 5 65148596 missense probably damaging 1.00
R9528:Klhl5 UTSW 5 65156243 critical splice donor site probably null
R9688:Klhl5 UTSW 5 65164587 missense probably damaging 1.00
R9744:Klhl5 UTSW 5 65162912 missense probably damaging 1.00
X0009:Klhl5 UTSW 5 65162921 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGGCAGACATGGAAAACAATGCAC -3'
(R):5'- CCTCTAGGAACAACTGTTCACAGAATCC -3'

Sequencing Primer
(F):5'- GGAAAACAATGCACTTTTCCG -3'
(R):5'- gctttcctttccatctgtgtc -3'
Posted On 2013-10-16