Incidental Mutation 'R0783:Zfp128'
ID 76720
Institutional Source Beutler Lab
Gene Symbol Zfp128
Ensembl Gene ENSMUSG00000060397
Gene Name zinc finger protein 128
Synonyms mZnf8, 9630016P15Rik
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 12881177-12893422 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 12890272 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 189 (P189L)
Ref Sequence ENSEMBL: ENSMUSP00000115378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144578]
AlphaFold Q8BGV5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081891
Predicted Effect probably damaging
Transcript: ENSMUST00000144578
AA Change: P189L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115378
Gene: ENSMUSG00000060397
AA Change: P189L

DomainStartEndE-ValueType
KRAB 25 85 2.51e-38 SMART
ZnF_C2H2 254 276 8.47e-4 SMART
ZnF_C2H2 282 304 5.21e-4 SMART
ZnF_C2H2 310 332 4.17e-3 SMART
ZnF_C2H2 338 360 3.89e-3 SMART
ZnF_C2H2 366 388 1.47e-3 SMART
ZnF_C2H2 394 416 8.47e-4 SMART
ZnF_C2H2 464 486 3.39e-3 SMART
Meta Mutation Damage Score 0.1014 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Zfp128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zfp128 APN 7 12891022 missense probably benign 0.00
IGL01293:Zfp128 APN 7 12891424 makesense probably null
IGL02067:Zfp128 APN 7 12885050 missense possibly damaging 0.86
IGL02146:Zfp128 APN 7 12890032 missense possibly damaging 0.72
IGL02654:Zfp128 APN 7 12884679 missense possibly damaging 0.95
IGL03066:Zfp128 APN 7 12890117 missense probably benign 0.00
IGL03076:Zfp128 APN 7 12884709 missense possibly damaging 0.95
IGL03113:Zfp128 APN 7 12890387 missense probably benign 0.00
IGL03237:Zfp128 APN 7 12891026 missense probably benign 0.28
prayer UTSW 7 12890636 nonsense probably null
R1686:Zfp128 UTSW 7 12890636 nonsense probably null
R1806:Zfp128 UTSW 7 12891022 missense probably benign 0.00
R2021:Zfp128 UTSW 7 12890029 missense possibly damaging 0.96
R3792:Zfp128 UTSW 7 12884732 missense probably damaging 0.98
R4105:Zfp128 UTSW 7 12884740 missense probably damaging 0.99
R4167:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R4168:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R5743:Zfp128 UTSW 7 12884727 missense probably damaging 1.00
R6266:Zfp128 UTSW 7 12890970 missense possibly damaging 0.80
R6799:Zfp128 UTSW 7 12890899 missense possibly damaging 0.93
R7102:Zfp128 UTSW 7 12890472 missense probably damaging 1.00
R7313:Zfp128 UTSW 7 12890534 missense possibly damaging 0.94
R7428:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R7504:Zfp128 UTSW 7 12890478 missense probably damaging 0.99
R7539:Zfp128 UTSW 7 12890552 nonsense probably null
R7636:Zfp128 UTSW 7 12890112 missense probably benign
R7755:Zfp128 UTSW 7 12890313 nonsense probably null
R7820:Zfp128 UTSW 7 12891022 missense probably benign 0.00
R8269:Zfp128 UTSW 7 12890736 missense probably damaging 1.00
R8932:Zfp128 UTSW 7 12891186 missense possibly damaging 0.91
R9361:Zfp128 UTSW 7 12890437 missense probably damaging 0.99
R9381:Zfp128 UTSW 7 12890970 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCAAAGGCTGTTCCTTGTCGTTC -3'
(R):5'- AGGTATAAGGCTTCTCCCCAGTGTG -3'

Sequencing Primer
(F):5'- CGTTCTATGATAGGGATAGATCAGG -3'
(R):5'- caaaaagatttcccacattcatcac -3'
Posted On 2013-10-16