Incidental Mutation 'R0783:Klk8'
ID 76721
Institutional Source Beutler Lab
Gene Symbol Klk8
Ensembl Gene ENSMUSG00000064023
Gene Name kallikrein related-peptidase 8
Synonyms BSP1, Nrpn, Prss19
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43797577-43803826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43802197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 204 (G204E)
Ref Sequence ENSEMBL: ENSMUSP00000145580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085461] [ENSMUST00000205537]
AlphaFold Q61955
Predicted Effect probably damaging
Transcript: ENSMUST00000085461
AA Change: G204E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082588
Gene: ENSMUSG00000064023
AA Change: G204E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 32 252 8.87e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205527
Predicted Effect probably damaging
Transcript: ENSMUST00000205537
AA Change: G204E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206465
Meta Mutation Damage Score 0.8276 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein exhibit impaired long-term potentiation and increased anxiety, as well as a hyperkeratosis phenotype. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show aberrant synapses and neurons in the hippocampus CA1 field. Homozygotes for another null allele have normal LTP and spatial reference memory but show increased polyspiking in response to repetitive afferent stimulation and enhanced kainite-induced seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Klk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Klk8 APN 7 43803689 missense probably benign 0.14
R1733:Klk8 UTSW 7 43802121 missense possibly damaging 0.94
R2020:Klk8 UTSW 7 43799216 missense probably benign
R4036:Klk8 UTSW 7 43798087 missense probably null 0.00
R5648:Klk8 UTSW 7 43798644 missense possibly damaging 0.95
R6237:Klk8 UTSW 7 43798670 nonsense probably null
R7609:Klk8 UTSW 7 43802179 missense probably damaging 1.00
R7871:Klk8 UTSW 7 43799326 splice site probably null
R9456:Klk8 UTSW 7 43803753 missense probably benign 0.00
R9505:Klk8 UTSW 7 43802181 missense probably damaging 1.00
Z1176:Klk8 UTSW 7 43803725 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GACGTTAAGACTTGAGGGCTCCTG -3'
(R):5'- GTATGCCAACCTCACTCTGTGACC -3'

Sequencing Primer
(F):5'- TCTGTGGAATGTCCAGCCAAG -3'
(R):5'- AACCTCACTCTGTGACCTTCTG -3'
Posted On 2013-10-16