Incidental Mutation 'R0783:Olfr593'
ID 76723
Institutional Source Beutler Lab
Gene Symbol Olfr593
Ensembl Gene ENSMUSG00000073955
Gene Name olfactory receptor 593
Synonyms GA_x6K02T2PBJ9-5927412-5928362, MOR24-2
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103211862-103212845 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103212670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 259 (F259S)
Ref Sequence ENSEMBL: ENSMUSP00000147588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098206] [ENSMUST00000210686] [ENSMUST00000214051]
AlphaFold Q8VF28
Predicted Effect probably damaging
Transcript: ENSMUST00000098206
AA Change: F270S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095807
Gene: ENSMUSG00000073955
AA Change: F270S

DomainStartEndE-ValueType
Pfam:7tm_4 44 323 4.9e-106 PFAM
Pfam:7TM_GPCR_Srsx 48 320 2.6e-8 PFAM
Pfam:7tm_1 54 305 6.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210686
AA Change: F259S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000214051
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Olfr593
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Olfr593 APN 7 103212685 missense probably damaging 1.00
IGL01636:Olfr593 APN 7 103212177 missense probably benign
IGL01637:Olfr593 APN 7 103212177 missense probably benign
IGL02115:Olfr593 APN 7 103212474 missense probably damaging 1.00
IGL02668:Olfr593 APN 7 103212735 missense possibly damaging 0.88
IGL03063:Olfr593 APN 7 103212634 missense probably damaging 0.96
IGL03070:Olfr593 APN 7 103212697 missense probably benign 0.02
IGL03114:Olfr593 APN 7 103212721 missense probably damaging 1.00
R0144:Olfr593 UTSW 7 103212540 missense probably damaging 1.00
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0309:Olfr593 UTSW 7 103212721 missense probably damaging 1.00
R0602:Olfr593 UTSW 7 103212580 missense possibly damaging 0.76
R0677:Olfr593 UTSW 7 103212798 nonsense probably null
R1829:Olfr593 UTSW 7 103211886 missense probably benign 0.01
R3840:Olfr593 UTSW 7 103212693 missense probably damaging 1.00
R3841:Olfr593 UTSW 7 103212693 missense probably damaging 1.00
R4449:Olfr593 UTSW 7 103212480 missense probably benign 0.00
R4898:Olfr593 UTSW 7 103212540 missense probably damaging 1.00
R5197:Olfr593 UTSW 7 103212000 missense probably benign 0.02
R5285:Olfr593 UTSW 7 103212798 nonsense probably null
R6548:Olfr593 UTSW 7 103211904 missense probably benign 0.08
R7353:Olfr593 UTSW 7 103212309 missense probably damaging 1.00
R7362:Olfr593 UTSW 7 103212654 missense probably damaging 1.00
R7663:Olfr593 UTSW 7 103212445 missense possibly damaging 0.74
R7799:Olfr593 UTSW 7 103211979 missense probably benign 0.33
R8405:Olfr593 UTSW 7 103212201 missense probably benign 0.31
R8835:Olfr593 UTSW 7 103212721 missense probably damaging 1.00
R9417:Olfr593 UTSW 7 103211949 missense possibly damaging 0.51
R9429:Olfr593 UTSW 7 103212664 missense possibly damaging 0.74
X0067:Olfr593 UTSW 7 103212048 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCCTTCCTCACAGGCGGAGTAG -3'
(R):5'- GGGTTGCAAAATGGGCAATGAAATTTAC -3'

Sequencing Primer
(F):5'- CAGGCGGAGTAGACTTCATATTG -3'
(R):5'- GACACTTTCAACTGAACCCATTTG -3'
Posted On 2013-10-16