Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Bbs9'

76726

Institutional Source

Beutler Lab

Gene Symbol

Bbs9

Ensembl Gene

ENSMUSG00000035919

Gene Name

Bardet-Biedl syndrome 9 (human)

Synonyms

E130103I17Rik, EST 3159894

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.889) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22475715-22888280 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22567714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 151 (L151S)

Ref Sequence

ENSEMBL: ENSMUSP00000116629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]

AlphaFold

Q811G0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039798
AA Change: L151S

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: L151S

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	421	8e-168	PFAM
Pfam:PHTB1_C	439	814	8.3e-163	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147405
AA Change: L151S

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: L151S

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	417	1.1e-166	PFAM
Pfam:PHTB1_C	440	818	7e-158	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147712
AA Change: L151S

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: L151S

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	421	8e-168	PFAM
Pfam:PHTB1_C	439	814	8.3e-163	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000150395
AA Change: L151S

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: L151S

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	421	8e-168	PFAM
Pfam:PHTB1_C	439	814	8.3e-163	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152719

Meta Mutation Damage Score

0.0931

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Bbs9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01349:Bbs9	APN	9	22887683	missense	probably benign	0.00
IGL01586:Bbs9	APN	9	22645997	missense	possibly damaging	0.46
IGL01646:Bbs9	APN	9	22670925	nonsense	probably null
IGL01654:Bbs9	APN	9	22490942	critical splice donor site	probably null
IGL02172:Bbs9	APN	9	22579476	missense	possibly damaging	0.65
IGL02212:Bbs9	APN	9	22812512	missense	probably benign	0.02
IGL02444:Bbs9	APN	9	22643787	missense	probably damaging	0.96
IGL02829:Bbs9	APN	9	22579484	missense	probably damaging	0.98
IGL03385:Bbs9	APN	9	22643748	missense	probably benign	0.19
corpulent	UTSW	9	22575196	critical splice donor site	probably null
Crapulence	UTSW	9	22567764	missense	probably damaging	1.00
R0038:Bbs9	UTSW	9	22504094	missense	probably benign	0.30
R0243:Bbs9	UTSW	9	22514001	missense	probably damaging	1.00
R0595:Bbs9	UTSW	9	22496815	missense	probably benign
R0688:Bbs9	UTSW	9	22567719	missense	probably damaging	0.98
R0726:Bbs9	UTSW	9	22793823	missense	probably damaging	0.99
R0749:Bbs9	UTSW	9	22575201	splice site	probably null
R1148:Bbs9	UTSW	9	22575100	splice site	probably benign
R1532:Bbs9	UTSW	9	22887649	missense	probably benign	0.00
R1783:Bbs9	UTSW	9	22659119	missense	possibly damaging	0.85
R2285:Bbs9	UTSW	9	22678934	missense	probably damaging	1.00
R2402:Bbs9	UTSW	9	22646063	missense	probably benign	0.23
R2655:Bbs9	UTSW	9	22504052	missense	probably damaging	1.00
R3428:Bbs9	UTSW	9	22567887	splice site	probably benign
R3798:Bbs9	UTSW	9	22638769	missense	probably damaging	1.00
R3806:Bbs9	UTSW	9	22887630	missense	probably damaging	0.98
R4660:Bbs9	UTSW	9	22578767	missense	probably benign	0.16
R4873:Bbs9	UTSW	9	22578715	missense	probably benign	0.06
R4875:Bbs9	UTSW	9	22578715	missense	probably benign	0.06
R5291:Bbs9	UTSW	9	22628997	missense	probably damaging	1.00
R5364:Bbs9	UTSW	9	22575196	critical splice donor site	probably null
R5502:Bbs9	UTSW	9	22504074	missense	probably damaging	1.00
R5646:Bbs9	UTSW	9	22578715	missense	probably benign	0.06
R5932:Bbs9	UTSW	9	22812331	missense	probably damaging	1.00
R6222:Bbs9	UTSW	9	22567851	missense	possibly damaging	0.88
R6451:Bbs9	UTSW	9	22567764	missense	probably damaging	1.00
R6547:Bbs9	UTSW	9	22514069	missense	probably benign	0.01
R6726:Bbs9	UTSW	9	22645964	missense	probably benign	0.00
R6745:Bbs9	UTSW	9	22670836	missense	probably benign	0.00
R6908:Bbs9	UTSW	9	22567723	missense	probably damaging	0.96
R6919:Bbs9	UTSW	9	22812544	critical splice donor site	probably null
R7102:Bbs9	UTSW	9	22579553	missense	probably damaging	1.00
R7536:Bbs9	UTSW	9	22670800	missense	probably damaging	1.00
R7712:Bbs9	UTSW	9	22670813	missense	probably benign	0.34
R8177:Bbs9	UTSW	9	22514063	missense	probably benign	0.08
R8190:Bbs9	UTSW	9	22678988	missense	probably damaging	1.00
R8241:Bbs9	UTSW	9	22678918	missense	probably benign	0.00
R8440:Bbs9	UTSW	9	22567750	missense	probably damaging	0.99
R8733:Bbs9	UTSW	9	22670832	missense	probably benign	0.03
R8737:Bbs9	UTSW	9	22678948	missense	probably benign	0.17
R8854:Bbs9	UTSW	9	22578764	missense	probably damaging	1.00
R8885:Bbs9	UTSW	9	22678938	missense	possibly damaging	0.67
R9135:Bbs9	UTSW	9	22578709	missense	probably damaging	1.00
X0027:Bbs9	UTSW	9	22655330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATTCAGAGCTTGCTTCATGCTG -3'
(R):5'- TCCACTTGTCTGCAAGAAGACACAG -3'

Sequencing Primer
(F):5'- AACTTGGGACATGCGTACCTG -3'
(R):5'- CACAGTTATGAAGGAATCCGTGC -3'

Posted On

2013-10-16