Incidental Mutation 'R0783:Irx2'
ID76731
Institutional Source Beutler Lab
Gene Symbol Irx2
Ensembl Gene ENSMUSG00000001504
Gene NameIroquois homeobox 2
SynonymsIRX6
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R0783 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location72628820-72634198 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 72632650 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]
Predicted Effect probably benign
Transcript: ENSMUST00000074372
SMART Domains Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
HOX 115 180 1.14e-12 SMART
low complexity region 188 196 N/A INTRINSIC
low complexity region 256 278 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
IRO 325 342 2.28e-5 SMART
low complexity region 346 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163393
Predicted Effect probably benign
Transcript: ENSMUST00000167067
SMART Domains Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504

DomainStartEndE-ValueType
HOX 21 86 1.14e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169028
Predicted Effect probably null
Transcript: ENSMUST00000172353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177421
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Irx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Irx2 APN 13 72631310 missense probably damaging 1.00
R0647:Irx2 UTSW 13 72630680 missense probably damaging 1.00
R0931:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R0932:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R1782:Irx2 UTSW 13 72631466 missense probably benign 0.19
R2844:Irx2 UTSW 13 72631590 missense probably damaging 1.00
R4656:Irx2 UTSW 13 72631298 missense probably damaging 1.00
R4963:Irx2 UTSW 13 72632610 missense possibly damaging 0.71
R5219:Irx2 UTSW 13 72631301 missense probably damaging 1.00
R5523:Irx2 UTSW 13 72631595 missense probably damaging 1.00
R6663:Irx2 UTSW 13 72629129 missense probably damaging 1.00
R7311:Irx2 UTSW 13 72631277 missense probably damaging 0.98
R7411:Irx2 UTSW 13 72629063 start codon destroyed probably null 0.99
R7487:Irx2 UTSW 13 72630620 missense probably damaging 1.00
R7506:Irx2 UTSW 13 72629209 missense probably damaging 1.00
R7792:Irx2 UTSW 13 72631374 missense possibly damaging 0.88
R7953:Irx2 UTSW 13 72629224 missense probably benign 0.02
Z1177:Irx2 UTSW 13 72629089 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAACTCTGCATCCCCGAGACTG -3'
(R):5'- GGATACTGAACACCAAGTAGCAGGC -3'

Sequencing Primer
(F):5'- AATAACGTGGATCTTAGATGCCCC -3'
(R):5'- tgtgtgtgtgtgtgtTCTGTTTAG -3'
Posted On2013-10-16