Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Camk2g'

76732

Institutional Source

Beutler Lab

Gene Symbol

Camk2g

Ensembl Gene

ENSMUSG00000021820

Gene Name

calcium/calmodulin-dependent protein kinase II gamma

Synonyms

CaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20734875-20794088 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20744636 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 173 (T173S)

Ref Sequence

ENSEMBL: ENSMUSP00000152903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000224887] [ENSMUST00000225609] [ENSMUST00000226630]

AlphaFold

Q923T9

Predicted Effect

probably benign
Transcript: ENSMUST00000071816
AA Change: T369S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820
AA Change: T369S

Domain	Start	End	E-Value	Type
S_TKc	14	272	6.15e-106	SMART
low complexity region	323	338	N/A	INTRINSIC
Pfam:CaMKII_AD	397	524	2.7e-62	PFAM
Pfam:DUF4440	401	514	3.9e-12	PFAM
Pfam:SnoaL_3	401	526	4.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000080440
AA Change: T358S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820
AA Change: T358S

Domain	Start	End	E-Value	Type
S_TKc	14	272	6.15e-106	SMART
Pfam:CaMKII_AD	386	513	3.7e-63	PFAM
Pfam:DUF4440	390	504	3.2e-14	PFAM
Pfam:SnoaL_3	390	515	4.1e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100837
AA Change: T335S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820
AA Change: T335S

Domain	Start	End	E-Value	Type
S_TKc	14	272	6.15e-106	SMART
Pfam:CaMKII_AD	363	490	3.8e-63	PFAM
Pfam:DUF4440	367	481	3.6e-14	PFAM
Pfam:SnoaL_3	367	492	4.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223712
AA Change: T140S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000224887
AA Change: T147S

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225463
AA Change: T120S

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225609
AA Change: T173S

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225660

Predicted Effect

probably benign
Transcript: ENSMUST00000226630
AA Change: T367S

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0964

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Camk2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00822:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00932:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00934:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00935:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00938:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL01151:Camk2g	APN	14	20765959	missense	probably damaging	1.00
IGL01578:Camk2g	APN	14	20747854	splice site	probably benign
IGL02749:Camk2g	APN	14	20766016	critical splice acceptor site	probably null
changchun	UTSW	14	20742708	nonsense	probably null
Jilin	UTSW	14	20766212	nonsense	probably null
jingyuetan	UTSW	14	20793931	missense	possibly damaging	0.57
Manchuria	UTSW	14	20764949	missense	probably damaging	1.00
F5770:Camk2g	UTSW	14	20739312	splice site	probably benign
R0047:Camk2g	UTSW	14	20771068	splice site	probably benign
R0761:Camk2g	UTSW	14	20766212	nonsense	probably null
R2239:Camk2g	UTSW	14	20739387	missense	probably damaging	1.00
R2240:Camk2g	UTSW	14	20765446	missense	probably damaging	1.00
R2380:Camk2g	UTSW	14	20739387	missense	probably damaging	1.00
R3623:Camk2g	UTSW	14	20755707	splice site	probably benign
R3842:Camk2g	UTSW	14	20764898	missense	probably damaging	0.99
R4909:Camk2g	UTSW	14	20792584	missense	probably benign	0.29
R5329:Camk2g	UTSW	14	20793931	missense	possibly damaging	0.57
R5613:Camk2g	UTSW	14	20737491	missense	probably damaging	0.98
R5763:Camk2g	UTSW	14	20739347	missense	probably damaging	1.00
R6294:Camk2g	UTSW	14	20764949	missense	probably damaging	1.00
R6345:Camk2g	UTSW	14	20737375	missense	probably damaging	1.00
R6698:Camk2g	UTSW	14	20742708	nonsense	probably null
R7010:Camk2g	UTSW	14	20741444	missense	probably benign
R7187:Camk2g	UTSW	14	20742712	missense	probably benign
R7257:Camk2g	UTSW	14	20747839	missense	probably benign	0.01
R7459:Camk2g	UTSW	14	20779207	missense	probably damaging	0.97
R7655:Camk2g	UTSW	14	20739342	missense	possibly damaging	0.69
R7656:Camk2g	UTSW	14	20739342	missense	possibly damaging	0.69
R8863:Camk2g	UTSW	14	20760176	missense	probably damaging	1.00
R9764:Camk2g	UTSW	14	20765430	missense	probably damaging	0.99
Z1176:Camk2g	UTSW	14	20764912	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTTAGACTAACAGCCCTGGACTC -3'
(R):5'- GCTCAGAATCCCACAGCTCTTCTTG -3'

Sequencing Primer
(F):5'- cagccctggactccataaac -3'
(R):5'- TGCTGTCAACTAAGTCCAGG -3'

Posted On

2013-10-16