Incidental Mutation 'R0783:Camk2g'
ID 76732
Institutional Source Beutler Lab
Gene Symbol Camk2g
Ensembl Gene ENSMUSG00000021820
Gene Name calcium/calmodulin-dependent protein kinase II gamma
Synonyms CaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 20734875-20794088 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20744636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 173 (T173S)
Ref Sequence ENSEMBL: ENSMUSP00000152903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000224887] [ENSMUST00000225609] [ENSMUST00000226630]
AlphaFold Q923T9
Predicted Effect probably benign
Transcript: ENSMUST00000071816
AA Change: T369S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820
AA Change: T369S

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
low complexity region 323 338 N/A INTRINSIC
Pfam:CaMKII_AD 397 524 2.7e-62 PFAM
Pfam:DUF4440 401 514 3.9e-12 PFAM
Pfam:SnoaL_3 401 526 4.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080440
AA Change: T358S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820
AA Change: T358S

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 386 513 3.7e-63 PFAM
Pfam:DUF4440 390 504 3.2e-14 PFAM
Pfam:SnoaL_3 390 515 4.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100837
AA Change: T335S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820
AA Change: T335S

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 363 490 3.8e-63 PFAM
Pfam:DUF4440 367 481 3.6e-14 PFAM
Pfam:SnoaL_3 367 492 4.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223712
AA Change: T140S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000224887
AA Change: T147S

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225463
AA Change: T120S

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225609
AA Change: T173S

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225660
Predicted Effect probably benign
Transcript: ENSMUST00000226630
AA Change: T367S

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Camk2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00822:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00932:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00934:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00935:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00938:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL01151:Camk2g APN 14 20765959 missense probably damaging 1.00
IGL01578:Camk2g APN 14 20747854 splice site probably benign
IGL02749:Camk2g APN 14 20766016 critical splice acceptor site probably null
changchun UTSW 14 20742708 nonsense probably null
Jilin UTSW 14 20766212 nonsense probably null
jingyuetan UTSW 14 20793931 missense possibly damaging 0.57
Manchuria UTSW 14 20764949 missense probably damaging 1.00
F5770:Camk2g UTSW 14 20739312 splice site probably benign
R0047:Camk2g UTSW 14 20771068 splice site probably benign
R0761:Camk2g UTSW 14 20766212 nonsense probably null
R2239:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R2240:Camk2g UTSW 14 20765446 missense probably damaging 1.00
R2380:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R3623:Camk2g UTSW 14 20755707 splice site probably benign
R3842:Camk2g UTSW 14 20764898 missense probably damaging 0.99
R4909:Camk2g UTSW 14 20792584 missense probably benign 0.29
R5329:Camk2g UTSW 14 20793931 missense possibly damaging 0.57
R5613:Camk2g UTSW 14 20737491 missense probably damaging 0.98
R5763:Camk2g UTSW 14 20739347 missense probably damaging 1.00
R6294:Camk2g UTSW 14 20764949 missense probably damaging 1.00
R6345:Camk2g UTSW 14 20737375 missense probably damaging 1.00
R6698:Camk2g UTSW 14 20742708 nonsense probably null
R7010:Camk2g UTSW 14 20741444 missense probably benign
R7187:Camk2g UTSW 14 20742712 missense probably benign
R7257:Camk2g UTSW 14 20747839 missense probably benign 0.01
R7459:Camk2g UTSW 14 20779207 missense probably damaging 0.97
R7655:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
R7656:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
R8863:Camk2g UTSW 14 20760176 missense probably damaging 1.00
R9764:Camk2g UTSW 14 20765430 missense probably damaging 0.99
Z1176:Camk2g UTSW 14 20764912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTAGACTAACAGCCCTGGACTC -3'
(R):5'- GCTCAGAATCCCACAGCTCTTCTTG -3'

Sequencing Primer
(F):5'- cagccctggactccataaac -3'
(R):5'- TGCTGTCAACTAAGTCCAGG -3'
Posted On 2013-10-16