Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Zfr'

76734

Institutional Source

Beutler Lab

Gene Symbol

Zfr

Ensembl Gene

ENSMUSG00000022201

Gene Name

zinc finger RNA binding protein

Synonyms

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0783 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

12117831-12185683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12162182 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 806 (V806A)

Ref Sequence

ENSEMBL: ENSMUSP00000118911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122941]

AlphaFold

O88532

Predicted Effect

probably damaging
Transcript: ENSMUST00000122941
AA Change: V806A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: V806A

Domain	Start	End	E-Value	Type
low complexity region	69	116	N/A	INTRINSIC
low complexity region	159	182	N/A	INTRINSIC
low complexity region	196	224	N/A	INTRINSIC
low complexity region	229	302	N/A	INTRINSIC
ZnF_U1	328	362	7.79e-6	SMART
ZnF_C2H2	331	355	4.94e0	SMART
ZnF_U1	379	413	1.84e-7	SMART
ZnF_C2H2	382	406	4.65e-1	SMART
low complexity region	429	448	N/A	INTRINSIC
low complexity region	468	483	N/A	INTRINSIC
ZnF_U1	579	613	2.01e-8	SMART
ZnF_C2H2	582	606	1.31e0	SMART
low complexity region	630	664	N/A	INTRINSIC
low complexity region	685	719	N/A	INTRINSIC
low complexity region	766	782	N/A	INTRINSIC
DZF	784	1038	5.42e-170	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155054

SMART Domains

Protein: ENSMUSP00000114992
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	19	53	N/A	INTRINSIC
PDB:4ATB\|D	56	94	6e-11	PDB
low complexity region	100	114	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156752
AA Change: V78A

SMART Domains

Protein: ENSMUSP00000119251
Gene: ENSMUSG00000022201
AA Change: V78A

Domain	Start	End	E-Value	Type
low complexity region	34	52	N/A	INTRINSIC
DZF	57	299	1.79e-152	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000157034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158625

Meta Mutation Damage Score

0.2175

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het

Other mutations in Zfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Zfr	APN	15	12159646	missense	probably benign	0.26
IGL01759:Zfr	APN	15	12159655	missense	probably damaging	0.99
IGL01935:Zfr	APN	15	12180712	missense	probably benign	0.42
IGL02056:Zfr	APN	15	12154447	missense	probably damaging	1.00
IGL03009:Zfr	APN	15	12162235	missense	probably damaging	1.00
IGL03147:Zfr	UTSW	15	12140552	nonsense	probably null
PIT4504001:Zfr	UTSW	15	12166158	missense	possibly damaging	0.48
R0377:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R0678:Zfr	UTSW	15	12184085	missense	probably damaging	1.00
R0787:Zfr	UTSW	15	12140548	missense	unknown
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1538:Zfr	UTSW	15	12150243	missense	possibly damaging	0.61
R1558:Zfr	UTSW	15	12140644	missense	unknown
R1619:Zfr	UTSW	15	12150387	missense	possibly damaging	0.52
R1924:Zfr	UTSW	15	12160629	missense	possibly damaging	0.74
R2163:Zfr	UTSW	15	12162223	missense	probably damaging	1.00
R2958:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2960:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2961:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2962:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2963:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R3012:Zfr	UTSW	15	12166163	missense	probably damaging	1.00
R3054:Zfr	UTSW	15	12154507	missense	probably damaging	1.00
R3429:Zfr	UTSW	15	12152920	missense	probably benign	0.00
R3611:Zfr	UTSW	15	12159762	critical splice donor site	probably null
R3825:Zfr	UTSW	15	12166191	missense	probably damaging	1.00
R3882:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4080:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4241:Zfr	UTSW	15	12149659	missense	probably damaging	1.00
R4366:Zfr	UTSW	15	12156330	missense	probably damaging	0.99
R4375:Zfr	UTSW	15	12118340	critical splice donor site	probably null
R4893:Zfr	UTSW	15	12136542	missense	unknown
R4899:Zfr	UTSW	15	12166145	missense	probably benign	0.11
R4915:Zfr	UTSW	15	12162112	critical splice acceptor site	probably null
R5870:Zfr	UTSW	15	12160615	missense	probably damaging	1.00
R6162:Zfr	UTSW	15	12146245	missense	unknown
R6163:Zfr	UTSW	15	12146245	missense	unknown
R6165:Zfr	UTSW	15	12146245	missense	unknown
R6187:Zfr	UTSW	15	12146231	small deletion	probably benign
R6251:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R6903:Zfr	UTSW	15	12136455	missense	unknown
R6959:Zfr	UTSW	15	12150323	missense	probably damaging	1.00
R7133:Zfr	UTSW	15	12180638	missense	probably damaging	1.00
R7167:Zfr	UTSW	15	12180929	missense	probably benign	0.01
R7212:Zfr	UTSW	15	12146223	nonsense	probably null
R7373:Zfr	UTSW	15	12140559	missense	unknown
R7489:Zfr	UTSW	15	12152982	missense	probably benign	0.24
R7602:Zfr	UTSW	15	12159677	missense	possibly damaging	0.56
R7623:Zfr	UTSW	15	12160528	missense	possibly damaging	0.83
R7896:Zfr	UTSW	15	12146377	missense	probably damaging	1.00
R8188:Zfr	UTSW	15	12171818	missense	probably damaging	1.00
R8289:Zfr	UTSW	15	12135271	missense	noncoding transcript
R8382:Zfr	UTSW	15	12152968	nonsense	probably null
R8475:Zfr	UTSW	15	12150369	missense	probably benign	0.08
R9124:Zfr	UTSW	15	12136671	missense	unknown
R9493:Zfr	UTSW	15	12180620	critical splice acceptor site	probably null
R9598:Zfr	UTSW	15	12162206	missense	probably damaging	0.99
R9631:Zfr	UTSW	15	12154542	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTGTACAAGCTCAGACCTTGAGAGA -3'
(R):5'- GCCCAAAATTAAAAGGCAGGCTGAAGTT -3'

Sequencing Primer
(F):5'- agccatctcaccagccc -3'
(R):5'- ACAGCAAGCTGTTTGGGT -3'

Posted On

2013-10-16