Incidental Mutation 'R0783:Olfr1494'
ID76742
Institutional Source Beutler Lab
Gene Symbol Olfr1494
Ensembl Gene ENSMUSG00000050865
Gene Nameolfactory receptor 1494
SynonymsMOR266-1, GA_x6K02T2RE5P-4082427-4083374
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0783 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13739728-13750479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13749676 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 190 (L190P)
Ref Sequence ENSEMBL: ENSMUSP00000146563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051768] [ENSMUST00000207836]
Predicted Effect probably damaging
Transcript: ENSMUST00000051768
AA Change: L190P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056291
Gene: ENSMUSG00000050865
AA Change: L190P

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
Pfam:7tm_4 35 313 3.2e-53 PFAM
Pfam:7tm_1 45 295 7.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207836
AA Change: L190P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214697
Meta Mutation Damage Score 0.2766 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Olfr1494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Olfr1494 APN 19 13749801 missense probably benign 0.04
IGL02335:Olfr1494 APN 19 13749934 missense probably benign 0.01
IGL02388:Olfr1494 APN 19 13749630 missense possibly damaging 0.91
IGL03231:Olfr1494 APN 19 13749385 missense probably benign 0.35
R0133:Olfr1494 UTSW 19 13749988 missense probably damaging 1.00
R0142:Olfr1494 UTSW 19 13749255 missense probably benign 0.00
R0561:Olfr1494 UTSW 19 13749298 missense probably damaging 1.00
R1826:Olfr1494 UTSW 19 13749347 missense probably benign 0.05
R1967:Olfr1494 UTSW 19 13750053 makesense probably null
R3706:Olfr1494 UTSW 19 13749112 missense probably benign 0.42
R5417:Olfr1494 UTSW 19 13749853 missense probably benign 0.18
R6508:Olfr1494 UTSW 19 13749354 missense probably damaging 1.00
R7126:Olfr1494 UTSW 19 13749523 missense possibly damaging 0.90
R7262:Olfr1494 UTSW 19 13749171 missense probably benign 0.02
R7395:Olfr1494 UTSW 19 13749138 missense probably damaging 0.98
R7740:Olfr1494 UTSW 19 13749964 missense probably benign 0.00
R7744:Olfr1494 UTSW 19 13750055 makesense probably null
R7864:Olfr1494 UTSW 19 13749346 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCATGACCAAGAAGCTGTGTGTCC -3'
(R):5'- GGCAATTTGGCGATCCTCATCCTC -3'

Sequencing Primer
(F):5'- CAAGAAGCTGTGTGTCCAGATG -3'
(R):5'- GCCTCAGATATACAAGGCTGC -3'
Posted On2013-10-16