Mutagenetix > Incidental Mutation

Incidental Mutation 'R0784:Atf6'

76745

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

038964-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R0784 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 170709947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 635 (F635L)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably benign
Transcript: ENSMUST00000027974
AA Change: F635L

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: F635L

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Meta Mutation Damage Score

0.0609

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.1%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,653,528		probably benign	Het
Adamts2	C	T	11: 50,668,003	R182W	probably damaging	Het
Ahr	C	T	12: 35,508,142	G293D	possibly damaging	Het
Akna	G	T	4: 63,376,888	T1028K	probably benign	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Asic2	T	A	11: 80,893,989	M324L	possibly damaging	Het
Atp8b2	A	T	3: 89,957,073	V195E	probably damaging	Het
Bicd1	T	A	6: 149,513,363	C525S	probably damaging	Het
Cbfa2t3	A	G	8: 122,650,487		probably benign	Het
Cd46	G	A	1: 195,092,194	T11M	possibly damaging	Het
Cecr2	A	G	6: 120,758,149	H754R	possibly damaging	Het
Clcn3	G	T	8: 60,929,203	D450E	probably benign	Het
Cobl	T	G	11: 12,266,843		probably benign	Het
Cyba	T	A	8: 122,427,683	T34S	probably benign	Het
Dennd1a	A	G	2: 38,021,414	L187P	probably damaging	Het
Dennd4c	A	T	4: 86,844,908	Q1817L	probably benign	Het
Drosha	T	C	15: 12,867,678		probably benign	Het
Dync1li2	A	G	8: 104,442,498	S34P	probably damaging	Het
Emilin2	T	A	17: 71,275,287	D148V	possibly damaging	Het
Galnt11	A	G	5: 25,258,909	D393G	probably damaging	Het
Gm5435	T	A	12: 82,496,180		noncoding transcript	Het
Gpr176	C	T	2: 118,373,052	V46M	possibly damaging	Het
Gpr85	T	A	6: 13,836,749	H52L	probably benign	Het
Grn	T	C	11: 102,434,502	M246T	possibly damaging	Het
Hnrnpul2	T	C	19: 8,825,052	F428L	possibly damaging	Het
Hoxa13	G	C	6: 52,259,937	N278K	probably damaging	Het
Irx5	A	G	8: 92,360,490	D350G	probably benign	Het
Kat2a	C	T	11: 100,710,841	M249I	probably benign	Het
Klhl29	T	C	12: 5,081,251	Y782C	probably damaging	Het
Kmt2c	A	T	5: 25,310,895	F2650Y	probably benign	Het
Lrp2	A	G	2: 69,518,365	I754T	probably benign	Het
Mpl	G	A	4: 118,446,406	P472S	possibly damaging	Het
Mtnr1b	A	G	9: 15,862,785	I326T	probably benign	Het
Myh9	A	G	15: 77,777,009		probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo9a	A	G	9: 59,896,545		probably benign	Het
Olfr1187-ps1	T	A	2: 88,540,167		noncoding transcript	Het
Olfr30	T	A	11: 58,455,305	I215F	possibly damaging	Het
Oraov1	A	T	7: 144,919,277	Y108F	probably benign	Het
Pcsk5	T	C	19: 17,714,769	M184V	probably benign	Het
Piezo2	T	A	18: 63,083,235	D1143V	probably damaging	Het
Prr36	G	T	8: 4,213,771		probably benign	Het
Rnf220	C	A	4: 117,277,998		probably benign	Het
Senp3	A	G	11: 69,680,448	L131P	probably damaging	Het
Shc4	A	C	2: 125,657,496	W354G	probably benign	Het
Slc6a15	A	G	10: 103,416,800		probably benign	Het
Smtnl2	T	C	11: 72,399,937	D394G	probably damaging	Het
Sry	G	T	Y: 2,662,731	Q310K	unknown	Het
St7l	A	G	3: 104,870,924	M126V	probably benign	Het
St8sia3	T	C	18: 64,271,701	W350R	probably damaging	Het
Stk35	A	T	2: 129,810,802	K408*	probably null	Het
Svs1	T	A	6: 48,987,301	M81K	possibly damaging	Het
Thsd7b	T	C	1: 129,595,359		probably benign	Het
Tmem106b	T	C	6: 13,084,253	V252A	probably damaging	Het
Trpm7	A	G	2: 126,846,072		probably null	Het
Ttf2	T	C	3: 100,962,710	D349G	probably benign	Het
Zfp386	T	A	12: 116,059,920	C419*	probably null	Het
Zfp541	A	G	7: 16,082,992		probably benign	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGCAGCGCACTTCCTGTTCTC -3'
(R):5'- CAAGTGTATTGACTGCTCCCACCC -3'

Sequencing Primer
(F):5'- CGCACTTCCTGTTCTCTCTTC -3'
(R):5'- CTGAACCCTCTGTTGAATCCTG -3'

Posted On

2013-10-16