Incidental Mutation 'R0784:Atf6'
ID 76745
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms Atf6alpha, 9130025P16Rik, ESTM49
MMRRC Submission 038964-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.183) question?
Stock # R0784 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170532243-170695340 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 170537516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 635 (F635L)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably benign
Transcript: ENSMUST00000027974
AA Change: F635L

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: F635L

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,890,985 (GRCm39) probably benign Het
Adamts2 C T 11: 50,558,830 (GRCm39) R182W probably damaging Het
Ahr C T 12: 35,558,141 (GRCm39) G293D possibly damaging Het
Akna G T 4: 63,295,125 (GRCm39) T1028K probably benign Het
Akp3 G A 1: 87,055,593 (GRCm39) G547R unknown Het
Aoc1l3 T A 6: 48,964,235 (GRCm39) M81K possibly damaging Het
Asic2 T A 11: 80,784,815 (GRCm39) M324L possibly damaging Het
Atp8b2 A T 3: 89,864,380 (GRCm39) V195E probably damaging Het
Bicd1 T A 6: 149,414,861 (GRCm39) C525S probably damaging Het
Cbfa2t3 A G 8: 123,377,226 (GRCm39) probably benign Het
Cd46 G A 1: 194,774,502 (GRCm39) T11M possibly damaging Het
Cecr2 A G 6: 120,735,110 (GRCm39) H754R possibly damaging Het
Clcn3 G T 8: 61,382,237 (GRCm39) D450E probably benign Het
Cobl T G 11: 12,216,843 (GRCm39) probably benign Het
Cyba T A 8: 123,154,422 (GRCm39) T34S probably benign Het
Dennd1a A G 2: 37,911,426 (GRCm39) L187P probably damaging Het
Dennd4c A T 4: 86,763,145 (GRCm39) Q1817L probably benign Het
Drosha T C 15: 12,867,764 (GRCm39) probably benign Het
Dync1li2 A G 8: 105,169,130 (GRCm39) S34P probably damaging Het
Emilin2 T A 17: 71,582,282 (GRCm39) D148V possibly damaging Het
Galnt11 A G 5: 25,463,907 (GRCm39) D393G probably damaging Het
Gm5435 T A 12: 82,542,954 (GRCm39) noncoding transcript Het
Gpr176 C T 2: 118,203,533 (GRCm39) V46M possibly damaging Het
Gpr85 T A 6: 13,836,748 (GRCm39) H52L probably benign Het
Grn T C 11: 102,325,328 (GRCm39) M246T possibly damaging Het
Hnrnpul2 T C 19: 8,802,416 (GRCm39) F428L possibly damaging Het
Hoxa13 G C 6: 52,236,917 (GRCm39) N278K probably damaging Het
Irx5 A G 8: 93,087,118 (GRCm39) D350G probably benign Het
Kat2a C T 11: 100,601,667 (GRCm39) M249I probably benign Het
Klhl29 T C 12: 5,131,251 (GRCm39) Y782C probably damaging Het
Kmt2c A T 5: 25,515,893 (GRCm39) F2650Y probably benign Het
Lrp2 A G 2: 69,348,709 (GRCm39) I754T probably benign Het
LTO1 A T 7: 144,473,014 (GRCm39) Y108F probably benign Het
Mpl G A 4: 118,303,603 (GRCm39) P472S possibly damaging Het
Mtnr1b A G 9: 15,774,081 (GRCm39) I326T probably benign Het
Myh9 A G 15: 77,661,209 (GRCm39) probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo9a A G 9: 59,803,828 (GRCm39) probably benign Het
Or2z2 T A 11: 58,346,131 (GRCm39) I215F possibly damaging Het
Or4ac1-ps1 T A 2: 88,370,511 (GRCm39) noncoding transcript Het
Pcsk5 T C 19: 17,692,133 (GRCm39) M184V probably benign Het
Piezo2 T A 18: 63,216,306 (GRCm39) D1143V probably damaging Het
Prr36 G T 8: 4,263,771 (GRCm39) probably benign Het
Rnf220 C A 4: 117,135,195 (GRCm39) probably benign Het
Senp3 A G 11: 69,571,274 (GRCm39) L131P probably damaging Het
Shc4 A C 2: 125,499,416 (GRCm39) W354G probably benign Het
Slc6a15 A G 10: 103,252,661 (GRCm39) probably benign Het
Smtnl2 T C 11: 72,290,763 (GRCm39) D394G probably damaging Het
Sry G T Y: 2,662,731 (GRCm39) Q310K unknown Het
St7l A G 3: 104,778,240 (GRCm39) M126V probably benign Het
St8sia3 T C 18: 64,404,772 (GRCm39) W350R probably damaging Het
Stk35 A T 2: 129,652,722 (GRCm39) K408* probably null Het
Thsd7b T C 1: 129,523,096 (GRCm39) probably benign Het
Tmem106b T C 6: 13,084,252 (GRCm39) V252A probably damaging Het
Trpm7 A G 2: 126,687,992 (GRCm39) probably null Het
Ttf2 T C 3: 100,870,026 (GRCm39) D349G probably benign Het
Zfp386 T A 12: 116,023,540 (GRCm39) C419* probably null Het
Zfp541 A G 7: 15,816,917 (GRCm39) probably benign Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170,616,175 (GRCm39) critical splice donor site probably null
IGL01431:Atf6 APN 1 170,680,571 (GRCm39) splice site probably benign
IGL01755:Atf6 APN 1 170,616,180 (GRCm39) missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170,646,989 (GRCm39) missense probably damaging 0.99
IGL02416:Atf6 APN 1 170,574,726 (GRCm39) nonsense probably null
IGL02903:Atf6 APN 1 170,627,283 (GRCm39) missense probably benign 0.00
IGL02989:Atf6 APN 1 170,616,252 (GRCm39) splice site probably benign
IGL03209:Atf6 APN 1 170,662,463 (GRCm39) missense probably benign
R0455:Atf6 UTSW 1 170,662,492 (GRCm39) missense probably benign 0.00
R0467:Atf6 UTSW 1 170,621,589 (GRCm39) missense probably damaging 1.00
R0491:Atf6 UTSW 1 170,614,913 (GRCm39) critical splice donor site probably null
R1486:Atf6 UTSW 1 170,622,260 (GRCm39) missense probably damaging 1.00
R1850:Atf6 UTSW 1 170,646,855 (GRCm39) missense probably damaging 1.00
R1945:Atf6 UTSW 1 170,682,710 (GRCm39) missense probably benign 0.00
R2164:Atf6 UTSW 1 170,622,304 (GRCm39) missense probably damaging 1.00
R3782:Atf6 UTSW 1 170,622,336 (GRCm39) nonsense probably null
R4454:Atf6 UTSW 1 170,621,608 (GRCm39) missense probably damaging 0.99
R4631:Atf6 UTSW 1 170,574,766 (GRCm39) splice site probably null
R4676:Atf6 UTSW 1 170,614,979 (GRCm39) missense probably damaging 1.00
R5772:Atf6 UTSW 1 170,574,758 (GRCm39) missense probably damaging 1.00
R5860:Atf6 UTSW 1 170,669,345 (GRCm39) missense possibly damaging 0.95
R5860:Atf6 UTSW 1 170,669,344 (GRCm39) missense probably damaging 1.00
R5950:Atf6 UTSW 1 170,662,448 (GRCm39) missense probably damaging 1.00
R6242:Atf6 UTSW 1 170,621,545 (GRCm39) missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170,695,238 (GRCm39) missense probably benign 0.00
R7032:Atf6 UTSW 1 170,627,181 (GRCm39) critical splice donor site probably null
R7472:Atf6 UTSW 1 170,643,060 (GRCm39) missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170,622,275 (GRCm39) missense probably benign
R8002:Atf6 UTSW 1 170,646,823 (GRCm39) missense probably benign 0.43
R8860:Atf6 UTSW 1 170,680,535 (GRCm39) missense probably null 0.95
R8956:Atf6 UTSW 1 170,621,576 (GRCm39) missense probably damaging 0.98
R9090:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9271:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9323:Atf6 UTSW 1 170,682,682 (GRCm39) nonsense probably null
R9500:Atf6 UTSW 1 170,574,708 (GRCm39) missense probably damaging 0.98
R9594:Atf6 UTSW 1 170,668,402 (GRCm39) missense probably benign 0.18
R9733:Atf6 UTSW 1 170,662,402 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCAGCGCACTTCCTGTTCTC -3'
(R):5'- CAAGTGTATTGACTGCTCCCACCC -3'

Sequencing Primer
(F):5'- CGCACTTCCTGTTCTCTCTTC -3'
(R):5'- CTGAACCCTCTGTTGAATCCTG -3'
Posted On 2013-10-16