Incidental Mutation 'R0784:Dennd1a'
ID 76747
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene Name DENN domain containing 1A
Synonyms 6030446I19Rik
MMRRC Submission 038964-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R0784 (G1)
Quality Score 219
Status Validated
Chromosome 2
Chromosomal Location 37689003-38177402 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37911426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 187 (L187P)
Ref Sequence ENSEMBL: ENSMUSP00000099848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000130472] [ENSMUST00000140552] [ENSMUST00000150896]
AlphaFold Q8K382
Predicted Effect probably damaging
Transcript: ENSMUST00000102787
AA Change: L187P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: L187P

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126889
Predicted Effect probably benign
Transcript: ENSMUST00000130472
SMART Domains Protein: ENSMUSP00000119892
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
Blast:uDENN 9 64 4e-20 BLAST
PDB:3TW8|C 44 105 3e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Predicted Effect probably benign
Transcript: ENSMUST00000150896
SMART Domains Protein: ENSMUSP00000116723
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204461
Meta Mutation Damage Score 0.9614 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,890,985 (GRCm39) probably benign Het
Adamts2 C T 11: 50,558,830 (GRCm39) R182W probably damaging Het
Ahr C T 12: 35,558,141 (GRCm39) G293D possibly damaging Het
Akna G T 4: 63,295,125 (GRCm39) T1028K probably benign Het
Akp3 G A 1: 87,055,593 (GRCm39) G547R unknown Het
Aoc1l3 T A 6: 48,964,235 (GRCm39) M81K possibly damaging Het
Asic2 T A 11: 80,784,815 (GRCm39) M324L possibly damaging Het
Atf6 A G 1: 170,537,516 (GRCm39) F635L probably benign Het
Atp8b2 A T 3: 89,864,380 (GRCm39) V195E probably damaging Het
Bicd1 T A 6: 149,414,861 (GRCm39) C525S probably damaging Het
Cbfa2t3 A G 8: 123,377,226 (GRCm39) probably benign Het
Cd46 G A 1: 194,774,502 (GRCm39) T11M possibly damaging Het
Cecr2 A G 6: 120,735,110 (GRCm39) H754R possibly damaging Het
Clcn3 G T 8: 61,382,237 (GRCm39) D450E probably benign Het
Cobl T G 11: 12,216,843 (GRCm39) probably benign Het
Cyba T A 8: 123,154,422 (GRCm39) T34S probably benign Het
Dennd4c A T 4: 86,763,145 (GRCm39) Q1817L probably benign Het
Drosha T C 15: 12,867,764 (GRCm39) probably benign Het
Dync1li2 A G 8: 105,169,130 (GRCm39) S34P probably damaging Het
Emilin2 T A 17: 71,582,282 (GRCm39) D148V possibly damaging Het
Galnt11 A G 5: 25,463,907 (GRCm39) D393G probably damaging Het
Gm5435 T A 12: 82,542,954 (GRCm39) noncoding transcript Het
Gpr176 C T 2: 118,203,533 (GRCm39) V46M possibly damaging Het
Gpr85 T A 6: 13,836,748 (GRCm39) H52L probably benign Het
Grn T C 11: 102,325,328 (GRCm39) M246T possibly damaging Het
Hnrnpul2 T C 19: 8,802,416 (GRCm39) F428L possibly damaging Het
Hoxa13 G C 6: 52,236,917 (GRCm39) N278K probably damaging Het
Irx5 A G 8: 93,087,118 (GRCm39) D350G probably benign Het
Kat2a C T 11: 100,601,667 (GRCm39) M249I probably benign Het
Klhl29 T C 12: 5,131,251 (GRCm39) Y782C probably damaging Het
Kmt2c A T 5: 25,515,893 (GRCm39) F2650Y probably benign Het
Lrp2 A G 2: 69,348,709 (GRCm39) I754T probably benign Het
LTO1 A T 7: 144,473,014 (GRCm39) Y108F probably benign Het
Mpl G A 4: 118,303,603 (GRCm39) P472S possibly damaging Het
Mtnr1b A G 9: 15,774,081 (GRCm39) I326T probably benign Het
Myh9 A G 15: 77,661,209 (GRCm39) probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo9a A G 9: 59,803,828 (GRCm39) probably benign Het
Or2z2 T A 11: 58,346,131 (GRCm39) I215F possibly damaging Het
Or4ac1-ps1 T A 2: 88,370,511 (GRCm39) noncoding transcript Het
Pcsk5 T C 19: 17,692,133 (GRCm39) M184V probably benign Het
Piezo2 T A 18: 63,216,306 (GRCm39) D1143V probably damaging Het
Prr36 G T 8: 4,263,771 (GRCm39) probably benign Het
Rnf220 C A 4: 117,135,195 (GRCm39) probably benign Het
Senp3 A G 11: 69,571,274 (GRCm39) L131P probably damaging Het
Shc4 A C 2: 125,499,416 (GRCm39) W354G probably benign Het
Slc6a15 A G 10: 103,252,661 (GRCm39) probably benign Het
Smtnl2 T C 11: 72,290,763 (GRCm39) D394G probably damaging Het
Sry G T Y: 2,662,731 (GRCm39) Q310K unknown Het
St7l A G 3: 104,778,240 (GRCm39) M126V probably benign Het
St8sia3 T C 18: 64,404,772 (GRCm39) W350R probably damaging Het
Stk35 A T 2: 129,652,722 (GRCm39) K408* probably null Het
Thsd7b T C 1: 129,523,096 (GRCm39) probably benign Het
Tmem106b T C 6: 13,084,252 (GRCm39) V252A probably damaging Het
Trpm7 A G 2: 126,687,992 (GRCm39) probably null Het
Ttf2 T C 3: 100,870,026 (GRCm39) D349G probably benign Het
Zfp386 T A 12: 116,023,540 (GRCm39) C419* probably null Het
Zfp541 A G 7: 15,816,917 (GRCm39) probably benign Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38,133,454 (GRCm39) nonsense probably null
IGL00490:Dennd1a APN 2 37,691,164 (GRCm39) missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37,706,994 (GRCm39) missense probably benign 0.30
IGL01065:Dennd1a APN 2 37,734,917 (GRCm39) missense probably benign 0.02
IGL01621:Dennd1a APN 2 37,734,821 (GRCm39) missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38,016,592 (GRCm39) missense probably damaging 1.00
IGL01799:Dennd1a APN 2 37,938,754 (GRCm39) missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37,742,406 (GRCm39) critical splice donor site probably null
contract UTSW 2 37,742,453 (GRCm39) missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37,748,472 (GRCm39) missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37,748,472 (GRCm39) missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38,016,652 (GRCm39) missense probably damaging 0.96
R1199:Dennd1a UTSW 2 37,851,728 (GRCm39) missense probably damaging 0.99
R1439:Dennd1a UTSW 2 37,933,412 (GRCm39) missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37,748,441 (GRCm39) missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37,742,446 (GRCm39) missense probably benign 0.18
R1720:Dennd1a UTSW 2 37,690,209 (GRCm39) nonsense probably null
R1967:Dennd1a UTSW 2 37,734,845 (GRCm39) missense probably benign
R2570:Dennd1a UTSW 2 37,734,795 (GRCm39) missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37,748,089 (GRCm39) missense possibly damaging 0.89
R4464:Dennd1a UTSW 2 38,133,402 (GRCm39) splice site probably benign
R4890:Dennd1a UTSW 2 38,066,238 (GRCm39) intron probably benign
R5395:Dennd1a UTSW 2 37,692,140 (GRCm39) missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37,691,138 (GRCm39) missense probably benign 0.00
R5882:Dennd1a UTSW 2 37,851,675 (GRCm39) missense probably damaging 1.00
R6285:Dennd1a UTSW 2 37,742,453 (GRCm39) missense possibly damaging 0.89
R6520:Dennd1a UTSW 2 37,851,759 (GRCm39) splice site probably null
R6934:Dennd1a UTSW 2 37,691,225 (GRCm39) missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37,851,666 (GRCm39) missense probably damaging 1.00
R7109:Dennd1a UTSW 2 37,938,804 (GRCm39) missense probably damaging 1.00
R7204:Dennd1a UTSW 2 37,929,215 (GRCm39) missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37,691,073 (GRCm39) missense probably benign
R7408:Dennd1a UTSW 2 37,742,184 (GRCm39) splice site probably null
R7446:Dennd1a UTSW 2 37,706,991 (GRCm39) missense possibly damaging 0.89
R7579:Dennd1a UTSW 2 37,748,444 (GRCm39) missense probably damaging 0.99
R7645:Dennd1a UTSW 2 37,911,375 (GRCm39) missense probably damaging 1.00
R7661:Dennd1a UTSW 2 37,734,841 (GRCm39) missense probably benign
R8132:Dennd1a UTSW 2 37,748,072 (GRCm39) missense probably damaging 1.00
R8305:Dennd1a UTSW 2 37,748,093 (GRCm39) missense probably damaging 1.00
R8369:Dennd1a UTSW 2 37,938,766 (GRCm39) missense probably damaging 1.00
R8418:Dennd1a UTSW 2 37,748,403 (GRCm39) missense probably benign 0.36
R8438:Dennd1a UTSW 2 37,746,150 (GRCm39) missense probably benign 0.08
R8544:Dennd1a UTSW 2 37,872,920 (GRCm39) splice site probably null
R8997:Dennd1a UTSW 2 37,690,497 (GRCm39) missense probably benign 0.14
R9052:Dennd1a UTSW 2 37,911,463 (GRCm39) missense probably damaging 1.00
R9087:Dennd1a UTSW 2 37,911,366 (GRCm39) critical splice donor site probably null
R9096:Dennd1a UTSW 2 37,690,077 (GRCm39) missense probably damaging 1.00
R9346:Dennd1a UTSW 2 37,911,447 (GRCm39) missense probably benign 0.12
Z1088:Dennd1a UTSW 2 37,690,704 (GRCm39) missense probably benign
Z1177:Dennd1a UTSW 2 37,690,269 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTTGACACTGTAAAGGGAC -3'
(R):5'- GCTTCCAGGTAGAAAGTGTGGGAC -3'

Sequencing Primer
(F):5'- AGGGACATGAATAATTAATGACGATG -3'
(R):5'- CAGGAAGAAGAGCACATGCC -3'
Posted On 2013-10-16