Incidental Mutation 'R0784:St7l'
ID 76756
Institutional Source Beutler Lab
Gene Symbol St7l
Ensembl Gene ENSMUSG00000045576
Gene Name suppression of tumorigenicity 7-like
Synonyms St7r
MMRRC Submission 038964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R0784 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 104864005-104930064 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104870924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 126 (M126V)
Ref Sequence ENSEMBL: ENSMUSP00000138577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059271] [ENSMUST00000106769] [ENSMUST00000123876] [ENSMUST00000183914] [ENSMUST00000200132]
AlphaFold Q8K4P7
Predicted Effect probably benign
Transcript: ENSMUST00000059271
AA Change: M126V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058455
Gene: ENSMUSG00000045576
AA Change: M126V

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 559 1.6e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106769
AA Change: M126V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102380
Gene: ENSMUSG00000045576
AA Change: M126V

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 420 8.2e-209 PFAM
Pfam:ST7 419 527 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123876
AA Change: M126V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138577
Gene: ENSMUSG00000045576
AA Change: M126V

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 282 6.7e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146237
Predicted Effect probably benign
Transcript: ENSMUST00000183914
SMART Domains Protein: ENSMUSP00000139266
Gene: ENSMUSG00000045576

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199186
Predicted Effect probably benign
Transcript: ENSMUST00000200132
AA Change: M126V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000143759
Gene: ENSMUSG00000045576
AA Change: M126V

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 212 2.7e-81 PFAM
Pfam:ST7 209 481 1.3e-167 PFAM
Meta Mutation Damage Score 0.1761 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the ST7 tumor suppressor gene found in the chromosome 7q31 region. This gene is clustered in a tail-to-tail manner with the WNT2B gene in a chromosomal region known to be deleted and rearranged in a variety of cancers. Several transcript variants encoding many different isoforms have been described, but some have not been fully characterized. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in St7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:St7l APN 3 104873579 splice site probably benign
IGL00919:St7l APN 3 104926466 missense probably damaging 1.00
IGL00945:St7l APN 3 104926482 missense probably damaging 0.96
IGL01644:St7l APN 3 104919456 nonsense probably null
IGL02158:St7l APN 3 104874832 missense possibly damaging 0.48
IGL02164:St7l APN 3 104922281 critical splice donor site probably null
IGL02331:St7l APN 3 104926588 missense probably damaging 0.98
IGL03220:St7l APN 3 104874823 splice site probably benign
R0118:St7l UTSW 3 104889303 missense probably damaging 0.97
R0320:St7l UTSW 3 104870913 nonsense probably null
R0345:St7l UTSW 3 104895809 splice site probably benign
R0714:St7l UTSW 3 104874928 missense probably benign 0.06
R1664:St7l UTSW 3 104870898 missense probably damaging 1.00
R1719:St7l UTSW 3 104870987 missense probably benign 0.00
R1800:St7l UTSW 3 104919496 missense probably damaging 1.00
R1882:St7l UTSW 3 104868047 missense probably damaging 1.00
R3692:St7l UTSW 3 104891554 missense probably benign 0.27
R3879:St7l UTSW 3 104926447 missense probably damaging 1.00
R5130:St7l UTSW 3 104895764 missense probably damaging 1.00
R5271:St7l UTSW 3 104868060 missense probably damaging 1.00
R5887:St7l UTSW 3 104874928 missense probably benign 0.06
R6191:St7l UTSW 3 104868033 missense probably damaging 1.00
R6252:St7l UTSW 3 104919503 critical splice donor site probably null
R7307:St7l UTSW 3 104889353 missense probably benign 0.03
R7442:St7l UTSW 3 104889329 missense possibly damaging 0.93
R7860:St7l UTSW 3 104926577 missense probably benign 0.05
R8523:St7l UTSW 3 104868057 missense probably damaging 1.00
R8934:St7l UTSW 3 104889318 missense probably damaging 1.00
R8935:St7l UTSW 3 104870888 missense probably damaging 1.00
Z1177:St7l UTSW 3 104865309 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCACCCACCCAAGAGCAGATTG -3'
(R):5'- catggcttacttgcATTTACAGGAAGGA -3'

Sequencing Primer
(F):5'- GCAGATTGTGCATGTAAAGTGC -3'
(R):5'- tcacctccctaagcccc -3'
Posted On 2013-10-16