Incidental Mutation 'R0784:Rnf220'
ID 76759
Institutional Source Beutler Lab
Gene Symbol Rnf220
Ensembl Gene ENSMUSG00000028677
Gene Name ring finger protein 220
Synonyms
MMRRC Submission 038964-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock # R0784 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 117271463-117497052 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 117277998 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030439] [ENSMUST00000094853] [ENSMUST00000102690] [ENSMUST00000221654]
AlphaFold Q6PDX6
Predicted Effect probably benign
Transcript: ENSMUST00000030439
SMART Domains Protein: ENSMUSP00000030439
Gene: ENSMUSG00000028677

DomainStartEndE-ValueType
Pfam:RNF220 217 339 3.5e-38 PFAM
Pfam:RNF220 325 444 4.9e-51 PFAM
RING 514 552 1.62e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094853
SMART Domains Protein: ENSMUSP00000092449
Gene: ENSMUSG00000028677

DomainStartEndE-ValueType
low complexity region 176 187 N/A INTRINSIC
RING 301 339 1.62e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102690
SMART Domains Protein: ENSMUSP00000099751
Gene: ENSMUSG00000028677

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
RING 193 231 1.62e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128122
SMART Domains Protein: ENSMUSP00000114642
Gene: ENSMUSG00000028677

DomainStartEndE-ValueType
low complexity region 94 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221157
Predicted Effect probably benign
Transcript: ENSMUST00000221654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223371
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Rnf220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rnf220 APN 4 117307675 missense probably benign 0.02
IGL01345:Rnf220 APN 4 117273270 nonsense probably null
IGL02097:Rnf220 APN 4 117273327 missense probably benign 0.00
IGL02245:Rnf220 APN 4 117299537 splice site probably benign
IGL02366:Rnf220 APN 4 117489783 missense probably benign
IGL02725:Rnf220 APN 4 117272379 splice site probably benign
IGL02801:Rnf220 APN 4 117273251 missense probably damaging 1.00
IGL02963:Rnf220 APN 4 117490192 missense probably damaging 0.97
BB007:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
BB017:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
PIT4131001:Rnf220 UTSW 4 117277369 critical splice donor site probably null
R0041:Rnf220 UTSW 4 117273284 missense probably damaging 1.00
R1107:Rnf220 UTSW 4 117285390 missense probably damaging 1.00
R1122:Rnf220 UTSW 4 117278080 missense probably benign 0.01
R1231:Rnf220 UTSW 4 117489884 missense probably damaging 0.98
R1708:Rnf220 UTSW 4 117489886 missense probably benign 0.00
R1794:Rnf220 UTSW 4 117307568 missense probably benign
R4488:Rnf220 UTSW 4 117489814 missense probably damaging 1.00
R4710:Rnf220 UTSW 4 117289214 unclassified probably benign
R4790:Rnf220 UTSW 4 117289055 missense probably benign 0.45
R4923:Rnf220 UTSW 4 117489600 missense possibly damaging 0.71
R5173:Rnf220 UTSW 4 117289274 start gained probably benign
R5334:Rnf220 UTSW 4 117272351 missense probably damaging 1.00
R5505:Rnf220 UTSW 4 117296091 intron probably benign
R5849:Rnf220 UTSW 4 117277612 missense possibly damaging 0.92
R7075:Rnf220 UTSW 4 117285882 missense probably benign 0.28
R7349:Rnf220 UTSW 4 117277818 missense probably damaging 0.99
R7478:Rnf220 UTSW 4 117296136 missense possibly damaging 0.94
R7541:Rnf220 UTSW 4 117489930 missense probably damaging 1.00
R7930:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
R8030:Rnf220 UTSW 4 117277828 missense probably damaging 1.00
R8202:Rnf220 UTSW 4 117489873 missense probably damaging 1.00
R8701:Rnf220 UTSW 4 117489993 missense probably damaging 0.99
R9268:Rnf220 UTSW 4 117489636 missense probably benign 0.09
R9452:Rnf220 UTSW 4 117296142 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CATGGTGGTCAAGGACAATAGACCC -3'
(R):5'- TGAGCAGAGACAACCTGAAGCTCC -3'

Sequencing Primer
(F):5'- CCCAAGGTTGCAGTAGGAC -3'
(R):5'- ACCAGTAATCACCTGAGTGTCTG -3'
Posted On 2013-10-16