Incidental Mutation 'R0784:Mpl'
ID 76760
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Name myeloproliferative leukemia virus oncogene
Synonyms TPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II
MMRRC Submission 038964-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0784 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118442415-118457513 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118446406 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 472 (P472S)
Ref Sequence ENSEMBL: ENSMUSP00000006556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
AlphaFold Q08351
Predicted Effect possibly damaging
Transcript: ENSMUST00000006556
AA Change: P472S

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: P472S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102671
AA Change: P464S

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: P464S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106375
AA Change: P405S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: P405S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168404
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Meta Mutation Damage Score 0.2992 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118455661 missense possibly damaging 0.94
IGL02096:Mpl APN 4 118457136 missense possibly damaging 0.46
IGL02681:Mpl APN 4 118448871 splice site probably benign
R0238:Mpl UTSW 4 118456863 splice site probably benign
R0309:Mpl UTSW 4 118446038 intron probably benign
R0539:Mpl UTSW 4 118443508 missense possibly damaging 0.68
R0558:Mpl UTSW 4 118444020 missense probably damaging 0.99
R0601:Mpl UTSW 4 118443536 missense probably benign 0.08
R1016:Mpl UTSW 4 118448913 missense probably damaging 1.00
R1532:Mpl UTSW 4 118448568 missense possibly damaging 0.63
R1590:Mpl UTSW 4 118444024 missense probably damaging 0.99
R1806:Mpl UTSW 4 118443532 missense possibly damaging 0.73
R1875:Mpl UTSW 4 118456829 missense probably benign
R1935:Mpl UTSW 4 118455739 missense probably benign 0.01
R2182:Mpl UTSW 4 118457413 missense probably benign
R2291:Mpl UTSW 4 118449000 missense probably benign 0.04
R2508:Mpl UTSW 4 118455757 missense probably damaging 1.00
R4242:Mpl UTSW 4 118456771 missense probably damaging 0.98
R4718:Mpl UTSW 4 118456724 missense probably benign 0.02
R4775:Mpl UTSW 4 118448580 missense probably damaging 1.00
R5158:Mpl UTSW 4 118456684 missense probably damaging 0.98
R5208:Mpl UTSW 4 118455881 missense probably benign 0.00
R5276:Mpl UTSW 4 118455721 missense probably benign
R5953:Mpl UTSW 4 118454510 missense possibly damaging 0.89
R5953:Mpl UTSW 4 118454511 missense probably damaging 0.99
R6439:Mpl UTSW 4 118448553 missense probably damaging 0.98
R6450:Mpl UTSW 4 118448700 splice site probably null
R6521:Mpl UTSW 4 118455117 critical splice donor site probably null
R6812:Mpl UTSW 4 118455264 missense probably benign 0.03
R6876:Mpl UTSW 4 118457120 missense probably damaging 1.00
R7095:Mpl UTSW 4 118444063 missense
R7100:Mpl UTSW 4 118457410 missense
R7173:Mpl UTSW 4 118448544 critical splice donor site probably null
R7177:Mpl UTSW 4 118448544 critical splice donor site probably null
R7512:Mpl UTSW 4 118448892 missense
R8377:Mpl UTSW 4 118444057 missense
R8411:Mpl UTSW 4 118446109 missense
R8458:Mpl UTSW 4 118444016 critical splice donor site probably null
R8498:Mpl UTSW 4 118449010 missense probably benign
R8672:Mpl UTSW 4 118448913 missense probably damaging 1.00
R8863:Mpl UTSW 4 118457405 missense
R8904:Mpl UTSW 4 118444066 missense
Z1177:Mpl UTSW 4 118443655 missense
Predicted Primers PCR Primer
(F):5'- AAAGCATCTGACCACGGCTGAC -3'
(R):5'- TTTCGATCACGCCAGCTCCAAG -3'

Sequencing Primer
(F):5'- TGCTGACTCCAGCCCTG -3'
(R):5'- TCTCAGGTGCTGGAGCCAT -3'
Posted On 2013-10-16