Incidental Mutation 'R0784:Prr36'
ID 76771
Institutional Source Beutler Lab
Gene Symbol Prr36
Ensembl Gene ENSMUSG00000064125
Gene Name proline rich 36
Synonyms BC068157
MMRRC Submission 038964-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R0784 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 4259543-4267459 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 4263771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168386] [ENSMUST00000175906] [ENSMUST00000176227] [ENSMUST00000177491]
AlphaFold E9PV26
Predicted Effect unknown
Transcript: ENSMUST00000168386
AA Change: R632S
SMART Domains Protein: ENSMUSP00000133114
Gene: ENSMUSG00000064125
AA Change: R632S

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.9e-10 PROSPERO
internal_repeat_1 87 106 5.9e-10 PROSPERO
low complexity region 109 123 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
low complexity region 390 425 N/A INTRINSIC
low complexity region 466 497 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 571 612 N/A INTRINSIC
low complexity region 647 726 N/A INTRINSIC
low complexity region 733 751 N/A INTRINSIC
low complexity region 755 780 N/A INTRINSIC
low complexity region 783 867 N/A INTRINSIC
low complexity region 1020 1045 N/A INTRINSIC
Pfam:DUF4596 1053 1098 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175906
SMART Domains Protein: ENSMUSP00000135713
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.38e-8 PROSPERO
internal_repeat_1 87 106 5.38e-8 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176227
Predicted Effect probably benign
Transcript: ENSMUST00000176645
Predicted Effect probably benign
Transcript: ENSMUST00000177491
SMART Domains Protein: ENSMUSP00000135130
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 1.65e-6 PROSPERO
internal_repeat_1 87 106 1.65e-6 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein of unknown function that contains internal regions of low complexity sequence. Alternative splicing results in multiple transcript variants. The transcript structure of the protein-coding variant at this locus is conserved between human and mouse. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,890,985 (GRCm39) probably benign Het
Adamts2 C T 11: 50,558,830 (GRCm39) R182W probably damaging Het
Ahr C T 12: 35,558,141 (GRCm39) G293D possibly damaging Het
Akna G T 4: 63,295,125 (GRCm39) T1028K probably benign Het
Akp3 G A 1: 87,055,593 (GRCm39) G547R unknown Het
Aoc1l3 T A 6: 48,964,235 (GRCm39) M81K possibly damaging Het
Asic2 T A 11: 80,784,815 (GRCm39) M324L possibly damaging Het
Atf6 A G 1: 170,537,516 (GRCm39) F635L probably benign Het
Atp8b2 A T 3: 89,864,380 (GRCm39) V195E probably damaging Het
Bicd1 T A 6: 149,414,861 (GRCm39) C525S probably damaging Het
Cbfa2t3 A G 8: 123,377,226 (GRCm39) probably benign Het
Cd46 G A 1: 194,774,502 (GRCm39) T11M possibly damaging Het
Cecr2 A G 6: 120,735,110 (GRCm39) H754R possibly damaging Het
Clcn3 G T 8: 61,382,237 (GRCm39) D450E probably benign Het
Cobl T G 11: 12,216,843 (GRCm39) probably benign Het
Cyba T A 8: 123,154,422 (GRCm39) T34S probably benign Het
Dennd1a A G 2: 37,911,426 (GRCm39) L187P probably damaging Het
Dennd4c A T 4: 86,763,145 (GRCm39) Q1817L probably benign Het
Drosha T C 15: 12,867,764 (GRCm39) probably benign Het
Dync1li2 A G 8: 105,169,130 (GRCm39) S34P probably damaging Het
Emilin2 T A 17: 71,582,282 (GRCm39) D148V possibly damaging Het
Galnt11 A G 5: 25,463,907 (GRCm39) D393G probably damaging Het
Gm5435 T A 12: 82,542,954 (GRCm39) noncoding transcript Het
Gpr176 C T 2: 118,203,533 (GRCm39) V46M possibly damaging Het
Gpr85 T A 6: 13,836,748 (GRCm39) H52L probably benign Het
Grn T C 11: 102,325,328 (GRCm39) M246T possibly damaging Het
Hnrnpul2 T C 19: 8,802,416 (GRCm39) F428L possibly damaging Het
Hoxa13 G C 6: 52,236,917 (GRCm39) N278K probably damaging Het
Irx5 A G 8: 93,087,118 (GRCm39) D350G probably benign Het
Kat2a C T 11: 100,601,667 (GRCm39) M249I probably benign Het
Klhl29 T C 12: 5,131,251 (GRCm39) Y782C probably damaging Het
Kmt2c A T 5: 25,515,893 (GRCm39) F2650Y probably benign Het
Lrp2 A G 2: 69,348,709 (GRCm39) I754T probably benign Het
LTO1 A T 7: 144,473,014 (GRCm39) Y108F probably benign Het
Mpl G A 4: 118,303,603 (GRCm39) P472S possibly damaging Het
Mtnr1b A G 9: 15,774,081 (GRCm39) I326T probably benign Het
Myh9 A G 15: 77,661,209 (GRCm39) probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo9a A G 9: 59,803,828 (GRCm39) probably benign Het
Or2z2 T A 11: 58,346,131 (GRCm39) I215F possibly damaging Het
Or4ac1-ps1 T A 2: 88,370,511 (GRCm39) noncoding transcript Het
Pcsk5 T C 19: 17,692,133 (GRCm39) M184V probably benign Het
Piezo2 T A 18: 63,216,306 (GRCm39) D1143V probably damaging Het
Rnf220 C A 4: 117,135,195 (GRCm39) probably benign Het
Senp3 A G 11: 69,571,274 (GRCm39) L131P probably damaging Het
Shc4 A C 2: 125,499,416 (GRCm39) W354G probably benign Het
Slc6a15 A G 10: 103,252,661 (GRCm39) probably benign Het
Smtnl2 T C 11: 72,290,763 (GRCm39) D394G probably damaging Het
Sry G T Y: 2,662,731 (GRCm39) Q310K unknown Het
St7l A G 3: 104,778,240 (GRCm39) M126V probably benign Het
St8sia3 T C 18: 64,404,772 (GRCm39) W350R probably damaging Het
Stk35 A T 2: 129,652,722 (GRCm39) K408* probably null Het
Thsd7b T C 1: 129,523,096 (GRCm39) probably benign Het
Tmem106b T C 6: 13,084,252 (GRCm39) V252A probably damaging Het
Trpm7 A G 2: 126,687,992 (GRCm39) probably null Het
Ttf2 T C 3: 100,870,026 (GRCm39) D349G probably benign Het
Zfp386 T A 12: 116,023,540 (GRCm39) C419* probably null Het
Zfp541 A G 7: 15,816,917 (GRCm39) probably benign Het
Other mutations in Prr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Prr36 APN 8 4,266,230 (GRCm39) missense probably benign 0.01
IGL01535:Prr36 APN 8 4,264,043 (GRCm39) unclassified probably benign
IGL01658:Prr36 APN 8 4,265,243 (GRCm39) missense probably damaging 1.00
IGL01710:Prr36 APN 8 4,265,243 (GRCm39) missense probably damaging 1.00
IGL01712:Prr36 APN 8 4,265,243 (GRCm39) missense probably damaging 1.00
IGL01713:Prr36 APN 8 4,265,243 (GRCm39) missense probably damaging 1.00
IGL01892:Prr36 APN 8 4,265,243 (GRCm39) missense probably damaging 1.00
IGL01893:Prr36 APN 8 4,265,243 (GRCm39) missense probably damaging 1.00
IGL02496:Prr36 APN 8 4,266,407 (GRCm39) nonsense probably null
IGL02829:Prr36 APN 8 4,265,278 (GRCm39) missense possibly damaging 0.55
R0479:Prr36 UTSW 8 4,263,930 (GRCm39) nonsense probably null
R0667:Prr36 UTSW 8 4,266,311 (GRCm39) unclassified probably benign
R1737:Prr36 UTSW 8 4,264,370 (GRCm39) unclassified probably benign
R2017:Prr36 UTSW 8 4,265,205 (GRCm39) missense probably benign 0.02
R2032:Prr36 UTSW 8 4,264,304 (GRCm39) unclassified probably benign
R2430:Prr36 UTSW 8 4,263,488 (GRCm39) unclassified probably benign
R4160:Prr36 UTSW 8 4,262,910 (GRCm39) missense probably benign 0.10
R4184:Prr36 UTSW 8 4,263,409 (GRCm39) unclassified probably benign
R4393:Prr36 UTSW 8 4,264,901 (GRCm39) unclassified probably benign
R4887:Prr36 UTSW 8 4,260,881 (GRCm39) missense probably benign 0.01
R5508:Prr36 UTSW 8 4,266,488 (GRCm39) missense probably damaging 0.99
R5628:Prr36 UTSW 8 4,266,273 (GRCm39) small deletion probably benign
R6189:Prr36 UTSW 8 4,264,177 (GRCm39) unclassified probably benign
R6277:Prr36 UTSW 8 4,264,746 (GRCm39) unclassified probably benign
R7185:Prr36 UTSW 8 4,266,458 (GRCm39) missense probably damaging 1.00
R7286:Prr36 UTSW 8 4,265,163 (GRCm39) critical splice donor site probably benign
R7338:Prr36 UTSW 8 4,266,212 (GRCm39) missense probably damaging 1.00
R7604:Prr36 UTSW 8 4,264,836 (GRCm39) missense unknown
R7621:Prr36 UTSW 8 4,263,150 (GRCm39) missense unknown
R7699:Prr36 UTSW 8 4,263,989 (GRCm39) missense unknown
R7703:Prr36 UTSW 8 4,262,982 (GRCm39) missense probably benign 0.03
R7842:Prr36 UTSW 8 4,260,953 (GRCm39) missense probably benign 0.09
R7853:Prr36 UTSW 8 4,263,905 (GRCm39) missense unknown
R8325:Prr36 UTSW 8 4,262,982 (GRCm39) missense probably benign 0.03
R8340:Prr36 UTSW 8 4,264,224 (GRCm39) missense unknown
R8353:Prr36 UTSW 8 4,263,831 (GRCm39) unclassified probably benign
R8777-TAIL:Prr36 UTSW 8 4,266,273 (GRCm39) small deletion probably benign
R9498:Prr36 UTSW 8 4,263,291 (GRCm39) missense unknown
R9502:Prr36 UTSW 8 4,264,775 (GRCm39) missense unknown
R9757:Prr36 UTSW 8 4,260,998 (GRCm39) missense probably damaging 1.00
RF044:Prr36 UTSW 8 4,266,273 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGACCCTGTGGAAAACATGTGGC -3'
(R):5'- GAGGCTCCCACTTTCTCAGACTTTG -3'

Sequencing Primer
(F):5'- GGCTGTGTCCAGGGAAG -3'
(R):5'- AGACTTTGCCCACTTCACAGG -3'
Posted On 2013-10-16