Mutagenetix > Incidental Mutation

Incidental Mutation 'R0784:Myo9a'

76778

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

038964-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0784 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 59896545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably benign
Transcript: ENSMUST00000128341

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135298

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136740

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151167

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.1%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,653,528		probably benign	Het
Adamts2	C	T	11: 50,668,003	R182W	probably damaging	Het
Ahr	C	T	12: 35,508,142	G293D	possibly damaging	Het
Akna	G	T	4: 63,376,888	T1028K	probably benign	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Asic2	T	A	11: 80,893,989	M324L	possibly damaging	Het
Atf6	A	G	1: 170,709,947	F635L	probably benign	Het
Atp8b2	A	T	3: 89,957,073	V195E	probably damaging	Het
Bicd1	T	A	6: 149,513,363	C525S	probably damaging	Het
Cbfa2t3	A	G	8: 122,650,487		probably benign	Het
Cd46	G	A	1: 195,092,194	T11M	possibly damaging	Het
Cecr2	A	G	6: 120,758,149	H754R	possibly damaging	Het
Clcn3	G	T	8: 60,929,203	D450E	probably benign	Het
Cobl	T	G	11: 12,266,843		probably benign	Het
Cyba	T	A	8: 122,427,683	T34S	probably benign	Het
Dennd1a	A	G	2: 38,021,414	L187P	probably damaging	Het
Dennd4c	A	T	4: 86,844,908	Q1817L	probably benign	Het
Drosha	T	C	15: 12,867,678		probably benign	Het
Dync1li2	A	G	8: 104,442,498	S34P	probably damaging	Het
Emilin2	T	A	17: 71,275,287	D148V	possibly damaging	Het
Galnt11	A	G	5: 25,258,909	D393G	probably damaging	Het
Gm5435	T	A	12: 82,496,180		noncoding transcript	Het
Gpr176	C	T	2: 118,373,052	V46M	possibly damaging	Het
Gpr85	T	A	6: 13,836,749	H52L	probably benign	Het
Grn	T	C	11: 102,434,502	M246T	possibly damaging	Het
Hnrnpul2	T	C	19: 8,825,052	F428L	possibly damaging	Het
Hoxa13	G	C	6: 52,259,937	N278K	probably damaging	Het
Irx5	A	G	8: 92,360,490	D350G	probably benign	Het
Kat2a	C	T	11: 100,710,841	M249I	probably benign	Het
Klhl29	T	C	12: 5,081,251	Y782C	probably damaging	Het
Kmt2c	A	T	5: 25,310,895	F2650Y	probably benign	Het
Lrp2	A	G	2: 69,518,365	I754T	probably benign	Het
Mpl	G	A	4: 118,446,406	P472S	possibly damaging	Het
Mtnr1b	A	G	9: 15,862,785	I326T	probably benign	Het
Myh9	A	G	15: 77,777,009		probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Olfr1187-ps1	T	A	2: 88,540,167		noncoding transcript	Het
Olfr30	T	A	11: 58,455,305	I215F	possibly damaging	Het
Oraov1	A	T	7: 144,919,277	Y108F	probably benign	Het
Pcsk5	T	C	19: 17,714,769	M184V	probably benign	Het
Piezo2	T	A	18: 63,083,235	D1143V	probably damaging	Het
Prr36	G	T	8: 4,213,771		probably benign	Het
Rnf220	C	A	4: 117,277,998		probably benign	Het
Senp3	A	G	11: 69,680,448	L131P	probably damaging	Het
Shc4	A	C	2: 125,657,496	W354G	probably benign	Het
Slc6a15	A	G	10: 103,416,800		probably benign	Het
Smtnl2	T	C	11: 72,399,937	D394G	probably damaging	Het
Sry	G	T	Y: 2,662,731	Q310K	unknown	Het
St7l	A	G	3: 104,870,924	M126V	probably benign	Het
St8sia3	T	C	18: 64,271,701	W350R	probably damaging	Het
Stk35	A	T	2: 129,810,802	K408*	probably null	Het
Svs1	T	A	6: 48,987,301	M81K	possibly damaging	Het
Thsd7b	T	C	1: 129,595,359		probably benign	Het
Tmem106b	T	C	6: 13,084,253	V252A	probably damaging	Het
Trpm7	A	G	2: 126,846,072		probably null	Het
Ttf2	T	C	3: 100,962,710	D349G	probably benign	Het
Zfp386	T	A	12: 116,059,920	C419*	probably null	Het
Zfp541	A	G	7: 16,082,992		probably benign	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
R9498:Myo9a	UTSW	9	59827183	missense	probably damaging	1.00
R9575:Myo9a	UTSW	9	59905907	missense	probably damaging	1.00
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGATTTACTTCAGCTCTGCACAGTTCC -3'
(R):5'- ggtcctcagcataatccAAAGTGGTACG -3'

Sequencing Primer
(F):5'- GCACAGTTCCTCTTGAAGAATAAAG -3'
(R):5'- caacattatggatgaatctcaagaac -3'

Posted On

2013-10-16