Mutagenetix > Incidental Mutation

Incidental Mutation 'R0784:Slc6a15'

76779

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

038964-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0784 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 103416800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

AlphaFold

Q8BG16

Predicted Effect

probably benign
Transcript: ENSMUST00000074204

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179636

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.1%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,653,528		probably benign	Het
Adamts2	C	T	11: 50,668,003	R182W	probably damaging	Het
Ahr	C	T	12: 35,508,142	G293D	possibly damaging	Het
Akna	G	T	4: 63,376,888	T1028K	probably benign	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Asic2	T	A	11: 80,893,989	M324L	possibly damaging	Het
Atf6	A	G	1: 170,709,947	F635L	probably benign	Het
Atp8b2	A	T	3: 89,957,073	V195E	probably damaging	Het
Bicd1	T	A	6: 149,513,363	C525S	probably damaging	Het
Cbfa2t3	A	G	8: 122,650,487		probably benign	Het
Cd46	G	A	1: 195,092,194	T11M	possibly damaging	Het
Cecr2	A	G	6: 120,758,149	H754R	possibly damaging	Het
Clcn3	G	T	8: 60,929,203	D450E	probably benign	Het
Cobl	T	G	11: 12,266,843		probably benign	Het
Cyba	T	A	8: 122,427,683	T34S	probably benign	Het
Dennd1a	A	G	2: 38,021,414	L187P	probably damaging	Het
Dennd4c	A	T	4: 86,844,908	Q1817L	probably benign	Het
Drosha	T	C	15: 12,867,678		probably benign	Het
Dync1li2	A	G	8: 104,442,498	S34P	probably damaging	Het
Emilin2	T	A	17: 71,275,287	D148V	possibly damaging	Het
Galnt11	A	G	5: 25,258,909	D393G	probably damaging	Het
Gm5435	T	A	12: 82,496,180		noncoding transcript	Het
Gpr176	C	T	2: 118,373,052	V46M	possibly damaging	Het
Gpr85	T	A	6: 13,836,749	H52L	probably benign	Het
Grn	T	C	11: 102,434,502	M246T	possibly damaging	Het
Hnrnpul2	T	C	19: 8,825,052	F428L	possibly damaging	Het
Hoxa13	G	C	6: 52,259,937	N278K	probably damaging	Het
Irx5	A	G	8: 92,360,490	D350G	probably benign	Het
Kat2a	C	T	11: 100,710,841	M249I	probably benign	Het
Klhl29	T	C	12: 5,081,251	Y782C	probably damaging	Het
Kmt2c	A	T	5: 25,310,895	F2650Y	probably benign	Het
Lrp2	A	G	2: 69,518,365	I754T	probably benign	Het
Mpl	G	A	4: 118,446,406	P472S	possibly damaging	Het
Mtnr1b	A	G	9: 15,862,785	I326T	probably benign	Het
Myh9	A	G	15: 77,777,009		probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo9a	A	G	9: 59,896,545		probably benign	Het
Olfr1187-ps1	T	A	2: 88,540,167		noncoding transcript	Het
Olfr30	T	A	11: 58,455,305	I215F	possibly damaging	Het
Oraov1	A	T	7: 144,919,277	Y108F	probably benign	Het
Pcsk5	T	C	19: 17,714,769	M184V	probably benign	Het
Piezo2	T	A	18: 63,083,235	D1143V	probably damaging	Het
Prr36	G	T	8: 4,213,771		probably benign	Het
Rnf220	C	A	4: 117,277,998		probably benign	Het
Senp3	A	G	11: 69,680,448	L131P	probably damaging	Het
Shc4	A	C	2: 125,657,496	W354G	probably benign	Het
Smtnl2	T	C	11: 72,399,937	D394G	probably damaging	Het
Sry	G	T	Y: 2,662,731	Q310K	unknown	Het
St7l	A	G	3: 104,870,924	M126V	probably benign	Het
St8sia3	T	C	18: 64,271,701	W350R	probably damaging	Het
Stk35	A	T	2: 129,810,802	K408*	probably null	Het
Svs1	T	A	6: 48,987,301	M81K	possibly damaging	Het
Thsd7b	T	C	1: 129,595,359		probably benign	Het
Tmem106b	T	C	6: 13,084,253	V252A	probably damaging	Het
Trpm7	A	G	2: 126,846,072		probably null	Het
Ttf2	T	C	3: 100,962,710	D349G	probably benign	Het
Zfp386	T	A	12: 116,059,920	C419*	probably null	Het
Zfp541	A	G	7: 16,082,992		probably benign	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTACTCAGGTTTATAGAAGACCTCACAGACA -3'
(R):5'- AGTAGTTCTACCTCAAAACAGACCTTCCA -3'

Sequencing Primer
(F):5'- CATGTTAGGATTTGCTCCAAGC -3'
(R):5'- AAGCTGTGCAATCACTGTTC -3'

Posted On

2013-10-16