Incidental Mutation 'R0784:Kat2a'
ID76786
Institutional Source Beutler Lab
Gene Symbol Kat2a
Ensembl Gene ENSMUSG00000020918
Gene NameK(lysine) acetyltransferase 2A
SynonymsGcn5, PCAF-B/GCN5, 1110051E14Rik, Gcn5l2
MMRRC Submission 038964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0784 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100704746-100712465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100710841 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 249 (M249I)
Ref Sequence ENSEMBL: ENSMUSP00000099407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006973] [ENSMUST00000017976] [ENSMUST00000019317] [ENSMUST00000103118] [ENSMUST00000107364] [ENSMUST00000169833]
Predicted Effect probably benign
Transcript: ENSMUST00000006973
AA Change: M249I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006973
Gene: ENSMUSG00000020918
AA Change: M249I

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 332 1.2e-155 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 538 621 5e-13 PFAM
Pfam:Acetyltransf_1 545 620 3.2e-11 PFAM
low complexity region 659 675 N/A INTRINSIC
BROMO 718 826 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017976
SMART Domains Protein: ENSMUSP00000017976
Gene: ENSMUSG00000017832

DomainStartEndE-ValueType
Pfam:HSP20 52 149 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019317
SMART Domains Protein: ENSMUSP00000019317
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 203 6.29e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103118
AA Change: M249I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099407
Gene: ENSMUSG00000020918
AA Change: M249I

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 331 4.4e-120 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 539 622 1.2e-11 PFAM
Pfam:Acetyltransf_1 547 621 3.1e-11 PFAM
low complexity region 660 676 N/A INTRINSIC
BROMO 719 827 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107364
SMART Domains Protein: ENSMUSP00000102987
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 185 3.37e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153526
Predicted Effect probably benign
Transcript: ENSMUST00000169833
SMART Domains Protein: ENSMUSP00000130551
Gene: ENSMUSG00000017832

DomainStartEndE-ValueType
Pfam:HSP20 83 178 1.2e-13 PFAM
Meta Mutation Damage Score 0.1209 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit poorly developed yolk sac blood vessels, retarded growth, absence of dorsal mesoderm lineages, failure to form somites, and lethality between embryonic days 9.5-11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Kat2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00476:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00952:Kat2a APN 11 100706151 missense probably damaging 0.98
IGL01529:Kat2a APN 11 100711909 missense probably damaging 1.00
IGL02424:Kat2a APN 11 100711147 unclassified probably null
IGL03338:Kat2a APN 11 100711475 missense probably benign 0.30
R0096:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0711:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0714:Kat2a UTSW 11 100711352 missense probably damaging 0.99
R1652:Kat2a UTSW 11 100708611 missense probably damaging 0.98
R2152:Kat2a UTSW 11 100712346 unclassified probably benign
R2177:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R2510:Kat2a UTSW 11 100712142 missense probably benign 0.32
R2570:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R4175:Kat2a UTSW 11 100705266 missense probably damaging 1.00
R4965:Kat2a UTSW 11 100712203 unclassified probably benign
R4965:Kat2a UTSW 11 100712204 unclassified probably benign
R5316:Kat2a UTSW 11 100712170 missense possibly damaging 0.77
R5732:Kat2a UTSW 11 100708240 missense probably damaging 1.00
R5954:Kat2a UTSW 11 100708898 missense possibly damaging 0.89
R6618:Kat2a UTSW 11 100712370 unclassified probably benign
R6719:Kat2a UTSW 11 100712141 missense probably benign 0.00
R6731:Kat2a UTSW 11 100708273 missense probably damaging 0.98
R7291:Kat2a UTSW 11 100710900 missense possibly damaging 0.55
R7373:Kat2a UTSW 11 100708566 missense probably benign 0.00
R7632:Kat2a UTSW 11 100708596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAAGGCTTCGGCCAAACACG -3'
(R):5'- TGGAAGGGTCAGAGGTTCTCTTCAC -3'

Sequencing Primer
(F):5'- TGGCAGTAACAGAGCCATC -3'
(R):5'- AGAGGTTCTCTTCACAGAATCC -3'
Posted On2013-10-16