Incidental Mutation 'R0784:Myh9'
ID 76794
Institutional Source Beutler Lab
Gene Symbol Myh9
Ensembl Gene ENSMUSG00000022443
Gene Name myosin, heavy polypeptide 9, non-muscle
Synonyms NMHC II-A, D0Jmb2, myosin IIA, Fltn, Myhn1, Myhn-1, E030044M24Rik
MMRRC Submission 038964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0784 (G1)
Quality Score 177
Status Validated
Chromosome 15
Chromosomal Location 77760587-77842175 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 77777009 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016771] [ENSMUST00000231192]
AlphaFold Q8VDD5
Predicted Effect probably benign
Transcript: ENSMUST00000016771
SMART Domains Protein: ENSMUSP00000016771
Gene: ENSMUSG00000022443

DomainStartEndE-ValueType
Pfam:Myosin_N 29 69 3.4e-11 PFAM
MYSc 75 777 N/A SMART
IQ 778 800 1.46e-3 SMART
Pfam:Myosin_tail_1 841 1921 N/A PFAM
low complexity region 1948 1959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231192
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display hearing loss with incomplete penetrance. Mice homozygous or heterozygous for one of several knock-in alleles exhibit macrothrombocytopenia, nephritis, cataracts and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Myh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Myh9 APN 15 77796995 splice site probably benign
IGL01105:Myh9 APN 15 77781478 missense probably benign 0.01
IGL01137:Myh9 APN 15 77769542 missense probably benign 0.19
IGL01399:Myh9 APN 15 77767270 missense probably damaging 1.00
IGL01666:Myh9 APN 15 77761931 missense probably benign 0.31
IGL01832:Myh9 APN 15 77791753 missense probably benign 0.02
IGL01933:Myh9 APN 15 77781218 missense probably benign 0.00
IGL02049:Myh9 APN 15 77769870 missense probably benign 0.01
IGL02237:Myh9 APN 15 77786654 missense probably benign 0.03
IGL02243:Myh9 APN 15 77767482 missense probably damaging 1.00
IGL02248:Myh9 APN 15 77786614 missense probably damaging 0.99
IGL02292:Myh9 APN 15 77807996 missense probably damaging 1.00
IGL02315:Myh9 APN 15 77769973 missense probably benign 0.00
IGL02427:Myh9 APN 15 77775804 missense probably damaging 0.98
IGL02675:Myh9 APN 15 77788930 missense possibly damaging 0.89
IGL02727:Myh9 APN 15 77791742 missense probably benign 0.11
IGL02749:Myh9 APN 15 77807986 nonsense probably null
IGL02887:Myh9 APN 15 77796020 nonsense probably null
IGL02926:Myh9 APN 15 77787626 missense probably damaging 1.00
IGL02945:Myh9 APN 15 77762005 missense probably benign 0.05
IGL03137:Myh9 APN 15 77791089 missense probably damaging 1.00
R1375:Myh9 UTSW 15 77769368 splice site probably null
R1535:Myh9 UTSW 15 77777813 missense probably damaging 0.98
R1563:Myh9 UTSW 15 77771857 missense probably damaging 0.99
R1629:Myh9 UTSW 15 77764401 missense probably damaging 1.00
R1635:Myh9 UTSW 15 77771167 missense probably benign 0.06
R1635:Myh9 UTSW 15 77775899 missense probably benign 0.00
R1693:Myh9 UTSW 15 77812897 missense probably damaging 1.00
R1791:Myh9 UTSW 15 77773264 unclassified probably benign
R2010:Myh9 UTSW 15 77771947 missense probably benign 0.06
R2048:Myh9 UTSW 15 77771132 missense possibly damaging 0.70
R2078:Myh9 UTSW 15 77763912 missense probably benign 0.16
R2092:Myh9 UTSW 15 77764350 nonsense probably null
R2376:Myh9 UTSW 15 77783417 missense probably benign 0.18
R2922:Myh9 UTSW 15 77813184 missense probably damaging 1.00
R3709:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3710:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3737:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3738:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3739:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R4299:Myh9 UTSW 15 77769964 missense probably benign
R4384:Myh9 UTSW 15 77791712 splice site probably benign
R4514:Myh9 UTSW 15 77764000 missense probably benign
R4631:Myh9 UTSW 15 77797028 missense probably damaging 0.99
R4642:Myh9 UTSW 15 77761951 missense probably benign 0.10
R4695:Myh9 UTSW 15 77768853 missense probably damaging 0.99
R4709:Myh9 UTSW 15 77787517 missense probably damaging 1.00
R4766:Myh9 UTSW 15 77807877 missense probably damaging 0.97
R4826:Myh9 UTSW 15 77788946 nonsense probably null
R4842:Myh9 UTSW 15 77769253 missense probably damaging 0.99
R4946:Myh9 UTSW 15 77773340 missense probably damaging 1.00
R5030:Myh9 UTSW 15 77807798 intron probably benign
R5055:Myh9 UTSW 15 77764523 missense probably benign 0.12
R5202:Myh9 UTSW 15 77781110 critical splice donor site probably null
R5413:Myh9 UTSW 15 77807986 nonsense probably null
R5435:Myh9 UTSW 15 77769609 missense probably benign 0.00
R5701:Myh9 UTSW 15 77791764 missense probably benign 0.00
R5757:Myh9 UTSW 15 77771162 missense probably benign 0.44
R5793:Myh9 UTSW 15 77768877 missense probably benign 0.23
R5952:Myh9 UTSW 15 77773332 missense possibly damaging 0.65
R6248:Myh9 UTSW 15 77785222 nonsense probably null
R6648:Myh9 UTSW 15 77766772 missense probably benign 0.08
R7055:Myh9 UTSW 15 77775198 missense probably damaging 1.00
R7106:Myh9 UTSW 15 77775121 missense probably benign
R7180:Myh9 UTSW 15 77807910 missense probably benign 0.00
R7205:Myh9 UTSW 15 77783472 missense probably benign 0.08
R7254:Myh9 UTSW 15 77765824 missense probably damaging 1.00
R7284:Myh9 UTSW 15 77787596 missense probably damaging 1.00
R7417:Myh9 UTSW 15 77763865 nonsense probably null
R7695:Myh9 UTSW 15 77766736 missense probably benign 0.31
R7750:Myh9 UTSW 15 77783410 missense probably benign 0.01
R7854:Myh9 UTSW 15 77791753 missense probably benign 0.02
R8220:Myh9 UTSW 15 77764547 missense possibly damaging 0.87
R8324:Myh9 UTSW 15 77788917 critical splice donor site probably null
R8837:Myh9 UTSW 15 77776937 missense possibly damaging 0.71
R8944:Myh9 UTSW 15 77771232 missense probably benign
R9025:Myh9 UTSW 15 77768992 missense probably benign
R9229:Myh9 UTSW 15 77790817 missense possibly damaging 0.91
R9396:Myh9 UTSW 15 77763296 missense probably benign
Z1088:Myh9 UTSW 15 77775258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCCTATGGAGCTACAGGAAAG -3'
(R):5'- TGGGCACAGACGGAAATCATGACC -3'

Sequencing Primer
(F):5'- CTTGTGATGTGGGCAACAAGC -3'
(R):5'- GACCACAGTTAGATCTTGCACTAAG -3'
Posted On 2013-10-16