Incidental Mutation 'R0784:Pcsk5'
ID76800
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 038964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0784 (G1)
Quality Score217
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17714769 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 184 (M184V)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect probably benign
Transcript: ENSMUST00000025618
AA Change: M184V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: M184V

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050715
AA Change: M184V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: M184V

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R7986:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R8032:Pcsk5 UTSW 19 17714787 missense probably damaging 0.98
R8064:Pcsk5 UTSW 19 17714861 missense probably damaging 1.00
R8115:Pcsk5 UTSW 19 17510166 critical splice donor site probably null
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGGCCACCCCATCAAAGG -3'
(R):5'- TCGTCTCACAGGAACATACCTCTGG -3'

Sequencing Primer
(F):5'- ATCTTGTGATCCCTGTGCTATAAGTG -3'
(R):5'- CAGTTACCCTCTTGAGGTAGATAACG -3'
Posted On2013-10-16