Incidental Mutation 'R0785:Pld5'
ID 76803
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Name phospholipase D family, member 5
Synonyms B230365F16Rik
MMRRC Submission 038965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0785 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 175962306-176275312 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 175975452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000104983] [ENSMUST00000111167] [ENSMUST00000125404]
AlphaFold Q3UNN8
Predicted Effect probably benign
Transcript: ENSMUST00000065967
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104983
SMART Domains Protein: ENSMUSP00000100599
Gene: ENSMUSG00000078184

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
RRM 74 147 8.44e-22 SMART
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111167
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.1%
  • 20x: 87.1%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,334 probably benign Het
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Adam10 A G 9: 70,767,888 E593G possibly damaging Het
Adh6a T C 3: 138,329,068 probably benign Het
AI464131 A G 4: 41,497,539 V697A probably benign Het
Akap6 T A 12: 52,886,622 I299N probably benign Het
Bod1l A T 5: 41,820,016 N1318K probably benign Het
Cd3eap G C 7: 19,357,285 S299C probably benign Het
Eif2b2 C A 12: 85,221,561 T170K probably damaging Het
Ermard T A 17: 15,021,977 H138Q probably damaging Het
Ern2 A T 7: 122,171,661 probably null Het
Fkbp11 T C 15: 98,726,549 K108R probably damaging Het
Gm6588 A G 5: 112,450,568 D327G probably benign Het
Golgb1 A G 16: 36,898,790 K353E possibly damaging Het
Hipk1 G T 3: 103,754,325 probably null Het
Itga4 A G 2: 79,289,305 D485G possibly damaging Het
Krt2 C A 15: 101,817,921 G61C unknown Het
Med12l T A 3: 59,260,832 L1561Q probably damaging Het
Mtmr14 T C 6: 113,277,947 probably null Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Nav2 T A 7: 49,420,333 H251Q probably benign Het
Nphp4 A G 4: 152,562,109 D1366G possibly damaging Het
Olfr1535 A G 13: 21,555,788 V78A probably benign Het
Olfr790 A G 10: 129,500,881 probably null Het
Pde6c A C 19: 38,133,180 M79L probably benign Het
Rps6kc1 A G 1: 190,808,945 V387A probably damaging Het
Tas2r136 T C 6: 132,777,927 D79G probably benign Het
Tmem243 A T 5: 9,118,488 K90I probably damaging Het
Topbp1 A G 9: 103,315,090 H260R probably damaging Het
Trappc1 A G 11: 69,324,810 probably benign Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp300 T C X: 21,082,925 Y200C possibly damaging Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 176140019 missense probably damaging 1.00
IGL00949:Pld5 APN 1 175975473 missense probably damaging 1.00
IGL01067:Pld5 APN 1 176274879 utr 5 prime probably benign
IGL02174:Pld5 APN 1 176274744 missense possibly damaging 0.86
IGL02380:Pld5 APN 1 176140044 missense probably damaging 0.97
IGL02879:Pld5 APN 1 175970591 missense probably damaging 1.00
R0087:Pld5 UTSW 1 175984459 missense probably damaging 0.98
R0135:Pld5 UTSW 1 175970589 missense probably damaging 1.00
R0144:Pld5 UTSW 1 175970541 missense probably benign 0.00
R0362:Pld5 UTSW 1 175975580 nonsense probably null
R0453:Pld5 UTSW 1 176089956 missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176274729 missense probably benign 0.00
R0722:Pld5 UTSW 1 175975515 missense probably benign 0.34
R0751:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1184:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1501:Pld5 UTSW 1 175975521 missense probably benign 0.36
R1644:Pld5 UTSW 1 175975626 missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175964013 missense probably benign 0.27
R2426:Pld5 UTSW 1 175963976 missense probably benign
R3508:Pld5 UTSW 1 175994037 missense probably damaging 1.00
R3917:Pld5 UTSW 1 175963938 missense probably benign 0.00
R4207:Pld5 UTSW 1 175993875 missense probably damaging 1.00
R4373:Pld5 UTSW 1 176140017 missense probably damaging 1.00
R4828:Pld5 UTSW 1 176274867 missense probably benign 0.06
R4831:Pld5 UTSW 1 176274884 utr 5 prime probably benign
R5861:Pld5 UTSW 1 176090005 missense probably damaging 1.00
R6182:Pld5 UTSW 1 176044854 missense probably benign 0.35
R6191:Pld5 UTSW 1 175970534 missense probably benign 0.04
R6246:Pld5 UTSW 1 175963909 nonsense probably null
R6737:Pld5 UTSW 1 176090022 missense probably damaging 1.00
R7082:Pld5 UTSW 1 176089876 missense probably benign 0.21
R7164:Pld5 UTSW 1 176213621 start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176274735 missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175993850 critical splice donor site probably null
R7805:Pld5 UTSW 1 176044914 missense probably damaging 1.00
R7967:Pld5 UTSW 1 176274698 missense probably benign 0.03
R8038:Pld5 UTSW 1 176044897 missense probably benign 0.19
R8995:Pld5 UTSW 1 175964014 missense probably benign 0.01
R9033:Pld5 UTSW 1 176140019 missense probably damaging 0.99
R9067:Pld5 UTSW 1 176089908 missense probably benign 0.00
R9156:Pld5 UTSW 1 175975538 missense possibly damaging 0.73
R9156:Pld5 UTSW 1 176074437 missense probably benign 0.05
X0004:Pld5 UTSW 1 176261522 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCGTGTTACAAATAAGGTCAGTAGGG -3'
(R):5'- CGGTTGCCACGATGCAGAATG -3'

Sequencing Primer
(F):5'- ggagagaccctgccttaaaac -3'
(R):5'- GCCTTGTAAAATTTCTTTCACGG -3'
Posted On 2013-10-16