Mutagenetix > Incidental Mutations

Incidental Mutation 'R0785:Ern2'

76821

Institutional Source

Beutler Lab

Gene Symbol

Ern2

Ensembl Gene

ENSMUSG00000030866

Gene Name

endoplasmic reticulum (ER) to nucleus signalling 2

Synonyms

Ire1b

MMRRC Submission

038965-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R0785 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122169893-122186207 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 122171661 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000033153 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000033153] [ENSMUST00000033154] [ENSMUST00000206198]

Predicted Effect

probably null
Transcript: ENSMUST00000033153

SMART Domains

Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000033153

SMART Domains

Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000033154

SMART Domains

Protein: ENSMUSP00000033154
Gene: ENSMUSG00000030867

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	20	35	N/A	INTRINSIC
S_TKc	53	305	7.36e-95	SMART
low complexity region	354	365	N/A	INTRINSIC
Pfam:POLO_box	418	479	4.4e-24	PFAM
Pfam:POLO_box	516	583	3.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000206198

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206202

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.1%
20x: 87.1%

Validation Efficiency

100% (36/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,959,334		probably benign	Het
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Adam10	A	G	9: 70,767,888	E593G	possibly damaging	Het
Adh6a	T	C	3: 138,329,068		probably benign	Het
AI464131	A	G	4: 41,497,539	V697A	probably benign	Het
Akap6	T	A	12: 52,886,622	I299N	probably benign	Het
Bod1l	A	T	5: 41,820,016	N1318K	probably benign	Het
Cd3eap	G	C	7: 19,357,285	S299C	probably benign	Het
Eif2b2	C	A	12: 85,221,561	T170K	probably damaging	Het
Ermard	T	A	17: 15,021,977	H138Q	probably damaging	Het
Fkbp11	T	C	15: 98,726,549	K108R	probably damaging	Het
Gm6588	A	G	5: 112,450,568	D327G	probably benign	Het
Golgb1	A	G	16: 36,898,790	K353E	possibly damaging	Het
Hipk1	G	T	3: 103,754,325		probably null	Het
Itga4	A	G	2: 79,289,305	D485G	possibly damaging	Het
Krt2	C	A	15: 101,817,921	G61C	unknown	Het
Med12l	T	A	3: 59,260,832	L1561Q	probably damaging	Het
Mtmr14	T	C	6: 113,277,947		probably null	Het
Naip1	A	G	13: 100,423,076	M1140T	probably benign	Het
Naip1	C	T	13: 100,423,085	R1137Q	probably benign	Het
Nav2	T	A	7: 49,420,333	H251Q	probably benign	Het
Nphp4	A	G	4: 152,562,109	D1366G	possibly damaging	Het
Olfr1535	A	G	13: 21,555,788	V78A	probably benign	Het
Olfr790	A	G	10: 129,500,881		probably null	Het
Pde6c	A	C	19: 38,133,180	M79L	probably benign	Het
Pld5	C	T	1: 175,975,452		probably benign	Het
Rps6kc1	A	G	1: 190,808,945	V387A	probably damaging	Het
Tas2r136	T	C	6: 132,777,927	D79G	probably benign	Het
Tmem243	A	T	5: 9,118,488	K90I	probably damaging	Het
Topbp1	A	G	9: 103,315,090	H260R	probably damaging	Het
Trappc1	A	G	11: 69,324,810		probably benign	Het
Vmn2r125	C	A	4: 156,351,101	A258D	probably benign	Het
Zfp300	T	C	X: 21,082,925	Y200C	possibly damaging	Het

Other mutations in Ern2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ern2	APN	7	122170092	missense	probably damaging	0.99
IGL01324:Ern2	APN	7	122183190	missense	possibly damaging	0.88
IGL02185:Ern2	APN	7	122173375	splice site	probably benign
IGL02738:Ern2	APN	7	122182899	missense	probably damaging	0.99
IGL02750:Ern2	APN	7	122181406	splice site	probably benign
IGL03247:Ern2	APN	7	122171671	missense	probably benign	0.02
ernie	UTSW	7	122171661	critical splice donor site	probably null
Ernie2	UTSW	7	122180862	splice site	probably benign
ernie3	UTSW	7	122173819	critical splice acceptor site	probably null
R0165:Ern2	UTSW	7	122179779	missense	probably benign	0.02
R0801:Ern2	UTSW	7	122180862	splice site	probably benign
R1345:Ern2	UTSW	7	122177770	missense	probably damaging	1.00
R1649:Ern2	UTSW	7	122177400	missense	probably damaging	1.00
R1747:Ern2	UTSW	7	122173819	critical splice acceptor site	probably null
R1747:Ern2	UTSW	7	122173820	critical splice acceptor site	probably null
R1846:Ern2	UTSW	7	122176536	missense	probably benign	0.32
R1899:Ern2	UTSW	7	122183842	splice site	probably benign
R1986:Ern2	UTSW	7	122171529	missense	probably benign	0.06
R2055:Ern2	UTSW	7	122183945	missense	possibly damaging	0.84
R2329:Ern2	UTSW	7	122173487	missense	possibly damaging	0.82
R2351:Ern2	UTSW	7	122171508	missense	probably damaging	0.97
R2894:Ern2	UTSW	7	122181587	missense	possibly damaging	0.94
R3176:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3276:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3945:Ern2	UTSW	7	122176530	missense	probably benign	0.10
R4303:Ern2	UTSW	7	122177846	critical splice acceptor site	probably null
R4874:Ern2	UTSW	7	122176587	missense	probably benign	0.28
R4943:Ern2	UTSW	7	122173258	missense	possibly damaging	0.95
R5184:Ern2	UTSW	7	122179959	missense	probably benign	0.03
R5629:Ern2	UTSW	7	122170166	missense	probably damaging	1.00
R5770:Ern2	UTSW	7	122179907	missense	possibly damaging	0.92
R6255:Ern2	UTSW	7	122173272	missense	probably damaging	1.00
R6272:Ern2	UTSW	7	122176646	missense	probably benign	0.05
R6277:Ern2	UTSW	7	122186107	missense	probably benign
R6624:Ern2	UTSW	7	122177783	missense	probably benign	0.00
R6940:Ern2	UTSW	7	122186146	missense	probably benign	0.01
R7491:Ern2	UTSW	7	122170533	missense	probably damaging	1.00
R7544:Ern2	UTSW	7	122173199	missense	probably benign	0.06
R7555:Ern2	UTSW	7	122170241	missense	probably damaging	1.00
R7843:Ern2	UTSW	7	122173708	missense	probably damaging	1.00
R8281:Ern2	UTSW	7	122170260	missense	probably damaging	1.00
R8321:Ern2	UTSW	7	122173208	missense	probably damaging	1.00
R8377:Ern2	UTSW	7	122181292	nonsense	probably null
R8548:Ern2	UTSW	7	122177839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCTTCCCAAGATCATCTAACCTGG -3'
(R):5'- CAGAGGGACTTTAGCAAGGCTCAC -3'

Sequencing Primer
(F):5'- TTAGCTCTGCTCCAAAAGAGG -3'
(R):5'- AGCAAGGCTCACTTCCTCC -3'

Posted On

2013-10-16