Incidental Mutation 'R0785:Eif2b2'
ID76826
Institutional Source Beutler Lab
Gene Symbol Eif2b2
Ensembl Gene ENSMUSG00000004788
Gene Nameeukaryotic translation initiation factor 2B, subunit 2 beta
SynonymsEIF2B, EIF-2Bbeta
MMRRC Submission 038965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0785 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85219481-85226628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85221561 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 170 (T170K)
Ref Sequence ENSEMBL: ENSMUSP00000122954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004910] [ENSMUST00000136495] [ENSMUST00000140900]
Predicted Effect probably damaging
Transcript: ENSMUST00000004910
AA Change: T173K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004910
Gene: ENSMUSG00000004788
AA Change: T173K

DomainStartEndE-ValueType
Pfam:IF-2B 27 333 3.2e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130760
Predicted Effect probably damaging
Transcript: ENSMUST00000136495
AA Change: T173K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122720
Gene: ENSMUSG00000004788
AA Change: T173K

DomainStartEndE-ValueType
Pfam:IF-2B 27 232 2e-51 PFAM
Pfam:IF-2B 229 287 4.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140900
AA Change: T170K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122954
Gene: ENSMUSG00000004788
AA Change: T170K

DomainStartEndE-ValueType
Pfam:IF-2B 27 228 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151925
Meta Mutation Damage Score 0.9251 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.1%
  • 20x: 87.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of eukaryotic initiation factor-2B (EIF2B). EIF2B is involved in protein synthesis and exchanges GDP and GTP for its activation and deactivation. Mutations in the human gene are associated with ovarioleukodystrophy and leukoencephalopathy with vanishing white matter. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,334 probably benign Het
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Adam10 A G 9: 70,767,888 E593G possibly damaging Het
Adh6a T C 3: 138,329,068 probably benign Het
AI464131 A G 4: 41,497,539 V697A probably benign Het
Akap6 T A 12: 52,886,622 I299N probably benign Het
Bod1l A T 5: 41,820,016 N1318K probably benign Het
Cd3eap G C 7: 19,357,285 S299C probably benign Het
Ermard T A 17: 15,021,977 H138Q probably damaging Het
Ern2 A T 7: 122,171,661 probably null Het
Fkbp11 T C 15: 98,726,549 K108R probably damaging Het
Gm6588 A G 5: 112,450,568 D327G probably benign Het
Golgb1 A G 16: 36,898,790 K353E possibly damaging Het
Hipk1 G T 3: 103,754,325 probably null Het
Itga4 A G 2: 79,289,305 D485G possibly damaging Het
Krt2 C A 15: 101,817,921 G61C unknown Het
Med12l T A 3: 59,260,832 L1561Q probably damaging Het
Mtmr14 T C 6: 113,277,947 probably null Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Nav2 T A 7: 49,420,333 H251Q probably benign Het
Nphp4 A G 4: 152,562,109 D1366G possibly damaging Het
Olfr1535 A G 13: 21,555,788 V78A probably benign Het
Olfr790 A G 10: 129,500,881 probably null Het
Pde6c A C 19: 38,133,180 M79L probably benign Het
Pld5 C T 1: 175,975,452 probably benign Het
Rps6kc1 A G 1: 190,808,945 V387A probably damaging Het
Tas2r136 T C 6: 132,777,927 D79G probably benign Het
Tmem243 A T 5: 9,118,488 K90I probably damaging Het
Topbp1 A G 9: 103,315,090 H260R probably damaging Het
Trappc1 A G 11: 69,324,810 probably benign Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp300 T C X: 21,082,925 Y200C possibly damaging Het
Other mutations in Eif2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Eif2b2 APN 12 85219834 missense probably benign 0.00
IGL03156:Eif2b2 APN 12 85219721 missense probably damaging 1.00
IGL03238:Eif2b2 APN 12 85223399 missense probably benign 0.01
R0471:Eif2b2 UTSW 12 85220183 missense probably benign
R1368:Eif2b2 UTSW 12 85223456 missense probably damaging 0.98
R1442:Eif2b2 UTSW 12 85219586 missense probably benign 0.00
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R5931:Eif2b2 UTSW 12 85222787 missense probably damaging 1.00
R6954:Eif2b2 UTSW 12 85226043 missense probably damaging 0.98
Z1177:Eif2b2 UTSW 12 85219564 start codon destroyed probably null 0.97
Z1177:Eif2b2 UTSW 12 85223415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTCCAGACAGCCACTCTCAAG -3'
(R):5'- GACTCCAGGCTGAGCTAATTGATTCAC -3'

Sequencing Primer
(F):5'- AGCCTGCTAAGCCTGTGATG -3'
(R):5'- CCTCTTACCTGGCAGAAAGGA -3'
Posted On2013-10-16