Incidental Mutation 'R0785:Krt2'
ID 76831
Institutional Source Beutler Lab
Gene Symbol Krt2
Ensembl Gene ENSMUSG00000064201
Gene Name keratin 2
Synonyms Krt2-17, Krt2-2, Krt2e
MMRRC Submission 038965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0785 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101810689-101818169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101817921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 61 (G61C)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold Q3TTY5
Predicted Effect unknown
Transcript: ENSMUST00000023712
AA Change: G61C
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: G61C

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Meta Mutation Damage Score 0.2443 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.1%
  • 20x: 87.1%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,334 probably benign Het
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Adam10 A G 9: 70,767,888 E593G possibly damaging Het
Adh6a T C 3: 138,329,068 probably benign Het
AI464131 A G 4: 41,497,539 V697A probably benign Het
Akap6 T A 12: 52,886,622 I299N probably benign Het
Bod1l A T 5: 41,820,016 N1318K probably benign Het
Cd3eap G C 7: 19,357,285 S299C probably benign Het
Eif2b2 C A 12: 85,221,561 T170K probably damaging Het
Ermard T A 17: 15,021,977 H138Q probably damaging Het
Ern2 A T 7: 122,171,661 probably null Het
Fkbp11 T C 15: 98,726,549 K108R probably damaging Het
Gm6588 A G 5: 112,450,568 D327G probably benign Het
Golgb1 A G 16: 36,898,790 K353E possibly damaging Het
Hipk1 G T 3: 103,754,325 probably null Het
Itga4 A G 2: 79,289,305 D485G possibly damaging Het
Med12l T A 3: 59,260,832 L1561Q probably damaging Het
Mtmr14 T C 6: 113,277,947 probably null Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Nav2 T A 7: 49,420,333 H251Q probably benign Het
Nphp4 A G 4: 152,562,109 D1366G possibly damaging Het
Olfr1535 A G 13: 21,555,788 V78A probably benign Het
Olfr790 A G 10: 129,500,881 probably null Het
Pde6c A C 19: 38,133,180 M79L probably benign Het
Pld5 C T 1: 175,975,452 probably benign Het
Rps6kc1 A G 1: 190,808,945 V387A probably damaging Het
Tas2r136 T C 6: 132,777,927 D79G probably benign Het
Tmem243 A T 5: 9,118,488 K90I probably damaging Het
Topbp1 A G 9: 103,315,090 H260R probably damaging Het
Trappc1 A G 11: 69,324,810 probably benign Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp300 T C X: 21,082,925 Y200C possibly damaging Het
Other mutations in Krt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt2 APN 15 101811211 missense probably benign 0.23
IGL01568:Krt2 APN 15 101813211 missense probably damaging 1.00
IGL01586:Krt2 APN 15 101811390 missense unknown
IGL01667:Krt2 APN 15 101816330 missense possibly damaging 0.85
IGL02017:Krt2 APN 15 101816504 missense probably damaging 1.00
IGL02022:Krt2 APN 15 101816518 missense probably damaging 1.00
IGL02538:Krt2 APN 15 101811154 missense unknown
IGL02959:Krt2 APN 15 101811328 missense unknown
IGL03295:Krt2 APN 15 101816429 missense probably damaging 0.99
R0195:Krt2 UTSW 15 101813191 nonsense probably null
R0472:Krt2 UTSW 15 101813253 missense probably damaging 1.00
R0749:Krt2 UTSW 15 101817663 missense unknown
R0792:Krt2 UTSW 15 101816497 missense probably damaging 1.00
R1232:Krt2 UTSW 15 101811784 missense probably damaging 1.00
R1281:Krt2 UTSW 15 101813292 missense probably damaging 1.00
R1770:Krt2 UTSW 15 101811154 missense unknown
R1783:Krt2 UTSW 15 101813973 missense probably damaging 1.00
R1795:Krt2 UTSW 15 101816426 missense possibly damaging 0.85
R2283:Krt2 UTSW 15 101814387 missense probably damaging 1.00
R3977:Krt2 UTSW 15 101811127 missense unknown
R4575:Krt2 UTSW 15 101814486 missense probably damaging 1.00
R4619:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4620:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4766:Krt2 UTSW 15 101813960 missense probably damaging 1.00
R4819:Krt2 UTSW 15 101811544 missense unknown
R4953:Krt2 UTSW 15 101813942 missense probably damaging 1.00
R5108:Krt2 UTSW 15 101813286 missense possibly damaging 0.88
R5973:Krt2 UTSW 15 101816312 missense probably damaging 0.99
R6122:Krt2 UTSW 15 101815914 missense probably damaging 1.00
R6180:Krt2 UTSW 15 101815044 missense probably benign 0.05
R6661:Krt2 UTSW 15 101815963 missense probably damaging 1.00
R6974:Krt2 UTSW 15 101817879 missense unknown
R6993:Krt2 UTSW 15 101815960 missense probably damaging 1.00
R7104:Krt2 UTSW 15 101815087 missense probably benign 0.09
R7573:Krt2 UTSW 15 101814519 missense probably benign 0.05
R7947:Krt2 UTSW 15 101816334 missense probably damaging 1.00
R8469:Krt2 UTSW 15 101816369 missense probably benign 0.22
R8805:Krt2 UTSW 15 101815944 missense possibly damaging 0.93
R9051:Krt2 UTSW 15 101817882 missense unknown
R9118:Krt2 UTSW 15 101814541 missense probably damaging 0.99
R9230:Krt2 UTSW 15 101817513 missense probably benign 0.39
R9257:Krt2 UTSW 15 101816491 missense probably benign 0.05
R9424:Krt2 UTSW 15 101811357 missense unknown
R9569:Krt2 UTSW 15 101816489 missense probably damaging 1.00
R9576:Krt2 UTSW 15 101811357 missense unknown
RF020:Krt2 UTSW 15 101817968 missense unknown
Z1177:Krt2 UTSW 15 101811550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAGAGGCTCTGATTGACAGACAC -3'
(R):5'- ACAGCACACTTTGGTCTCCAGC -3'

Sequencing Primer
(F):5'- TCATGGATACCTCCACCAGGG -3'
(R):5'- ACATCATGAGTTGCCAGATCTC -3'
Posted On 2013-10-16