Incidental Mutation 'R0786:Rhbg'
ID76841
Institutional Source Beutler Lab
Gene Symbol Rhbg
Ensembl Gene ENSMUSG00000104445
Gene NameRhesus blood group-associated B glycoprotein
Synonyms
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88242874-88254709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88244568 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 394 (M394I)
Ref Sequence ENSEMBL: ENSMUSP00000130767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171887]
Predicted Effect probably benign
Transcript: ENSMUST00000163277
Predicted Effect unknown
Transcript: ENSMUST00000165196
AA Change: M372I
SMART Domains Protein: ENSMUSP00000132187
Gene: ENSMUSG00000103766
AA Change: M372I

DomainStartEndE-ValueType
Pfam:Ammonium_transp 1 353 9.7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171887
AA Change: M394I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130767
Gene: ENSMUSG00000104445
AA Change: M394I

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:Ammonium_transp 22 419 5.9e-74 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-erythroid members of the Rhesus (Rh) protein family. Non-erythroid Rh protein family members are mainly expressed in the kidney and belong to the methylammonium-ammonium permease/ammonia transporters superfamily. All Rh family proteins are predicted to be transmembrane proteins with 12 membrane spanning domains and intracytoplasmic N- and C-termini. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, do not develop hyperammonemic hepatic encephalopathy or distal tubular acidosis, and show a normal renal response to chronic acid-loading and no changes in NH4+ or NH3 entry across the basolateral membrane of cortical collecting ducts cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Rhbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Rhbg UTSW 3 88254498 missense probably benign
R1397:Rhbg UTSW 3 88248446 missense probably benign 0.14
R1737:Rhbg UTSW 3 88245874 missense probably damaging 1.00
R1927:Rhbg UTSW 3 88244552 missense probably benign 0.00
R2088:Rhbg UTSW 3 88247458 missense probably damaging 1.00
R3976:Rhbg UTSW 3 88244536 missense probably damaging 1.00
R4056:Rhbg UTSW 3 88243448 missense probably damaging 1.00
R4669:Rhbg UTSW 3 88245966 missense probably damaging 1.00
R4878:Rhbg UTSW 3 88247453 missense probably benign 0.43
R5032:Rhbg UTSW 3 88245134 missense probably damaging 1.00
R5330:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5331:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5788:Rhbg UTSW 3 88245567 missense probably benign 0.00
R6293:Rhbg UTSW 3 88245826 nonsense probably null
R6882:Rhbg UTSW 3 88245220 missense probably damaging 1.00
R7493:Rhbg UTSW 3 88247579 missense probably damaging 1.00
R8024:Rhbg UTSW 3 88248453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGCAGGTGTTCTGAGAGAATC -3'
(R):5'- GCAGGCAAAAGAGACCTTTGACTGG -3'

Sequencing Primer
(F):5'- CTTGGTGGAAGTGAGCCTACAG -3'
(R):5'- CACTTGAAGTGAACCTGACTG -3'
Posted On2013-10-16