Incidental Mutation 'R0786:Melk'
ID76847
Institutional Source Beutler Lab
Gene Symbol Melk
Ensembl Gene ENSMUSG00000035683
Gene Namematernal embryonic leucine zipper kinase
SynonymsMPK38
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location44300876-44364675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44303649 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 14 (Y14C)
Ref Sequence ENSEMBL: ENSMUSP00000120242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045607] [ENSMUST00000125708] [ENSMUST00000137703]
Predicted Effect unknown
Transcript: ENSMUST00000045607
AA Change: Y14C
SMART Domains Protein: ENSMUSP00000043806
Gene: ENSMUSG00000035683
AA Change: Y14C

DomainStartEndE-ValueType
S_TKc 11 263 2.64e-105 SMART
low complexity region 313 325 N/A INTRINSIC
Pfam:KA1 599 643 2.2e-16 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125708
AA Change: Y14C
SMART Domains Protein: ENSMUSP00000118359
Gene: ENSMUSG00000035683
AA Change: Y14C

DomainStartEndE-ValueType
Pfam:Pkinase 11 91 1.9e-15 PFAM
Pfam:Pkinase_Tyr 11 97 4.3e-10 PFAM
Pfam:Pkinase 88 134 6.7e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137703
AA Change: Y14C
SMART Domains Protein: ENSMUSP00000120242
Gene: ENSMUSG00000035683
AA Change: Y14C

DomainStartEndE-ValueType
Pfam:Pkinase 11 88 7.7e-15 PFAM
Pfam:Pkinase_Tyr 11 88 3.1e-9 PFAM
Pfam:Pkinase_Tyr 87 212 1.5e-15 PFAM
Pfam:Pkinase 87 215 3.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137759
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an allele that produces a kinase-dead protein exhibit altered pancreatic regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Melk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Melk APN 4 44347262 missense probably benign 0.05
IGL01367:Melk APN 4 44332907 missense possibly damaging 0.62
IGL01865:Melk APN 4 44344988 missense probably benign 0.00
IGL02801:Melk APN 4 44360930 missense probably damaging 0.99
R0037:Melk UTSW 4 44360864 splice site probably benign
R0433:Melk UTSW 4 44340614 splice site probably benign
R0570:Melk UTSW 4 44308906 missense probably damaging 1.00
R1483:Melk UTSW 4 44308937 missense probably damaging 1.00
R2042:Melk UTSW 4 44309051 critical splice donor site probably null
R3831:Melk UTSW 4 44345021 missense probably benign 0.05
R5060:Melk UTSW 4 44350959 missense probably benign 0.15
R5236:Melk UTSW 4 44344959 missense probably benign
R5269:Melk UTSW 4 44363730 missense probably damaging 1.00
R5357:Melk UTSW 4 44363730 missense probably damaging 1.00
R5358:Melk UTSW 4 44363730 missense probably damaging 1.00
R5360:Melk UTSW 4 44363730 missense probably damaging 1.00
R5430:Melk UTSW 4 44309033 missense probably damaging 1.00
R5576:Melk UTSW 4 44312255 missense probably null 1.00
R5656:Melk UTSW 4 44312237 missense possibly damaging 0.95
R5738:Melk UTSW 4 44310333 missense probably damaging 1.00
R5972:Melk UTSW 4 44351007 missense probably benign 0.01
R6265:Melk UTSW 4 44318109 missense probably damaging 1.00
R6340:Melk UTSW 4 44340633 missense probably damaging 1.00
R7202:Melk UTSW 4 44351106 missense probably benign
R7242:Melk UTSW 4 44360885 missense probably damaging 1.00
R7328:Melk UTSW 4 44332931 missense probably benign
R7608:Melk UTSW 4 44325571 intron probably null
R8053:Melk UTSW 4 44318109 missense probably damaging 1.00
X0020:Melk UTSW 4 44349876 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ctCCTCCACCCAGCTCTGTTTGCTT -3'
(R):5'- TCAGtctcactagcttcaccctagcattc -3'

Sequencing Primer
(F):5'- GATCATTTACATGCCTAAGCTTTGTG -3'
(R):5'- CCCAAATAGACCATACTTTGAA -3'
Posted On2013-10-16