Incidental Mutation 'R0786:Col27a1'
ID76848
Institutional Source Beutler Lab
Gene Symbol Col27a1
Ensembl Gene ENSMUSG00000045672
Gene Namecollagen, type XXVII, alpha 1
Synonyms
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63214004-63334991 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 63291578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036300] [ENSMUST00000036300] [ENSMUST00000183913] [ENSMUST00000183913] [ENSMUST00000184067] [ENSMUST00000184067]
Predicted Effect probably null
Transcript: ENSMUST00000036300
SMART Domains Protein: ENSMUSP00000043816
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
TSPN 43 223 1.1e-5 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 356 372 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 455 467 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
Pfam:Collagen 609 670 2.1e-10 PFAM
Pfam:Collagen 666 731 3.7e-10 PFAM
low complexity region 790 808 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 858 880 N/A INTRINSIC
low complexity region 886 910 N/A INTRINSIC
low complexity region 912 946 N/A INTRINSIC
Pfam:Collagen 1012 1080 2.8e-8 PFAM
Pfam:Collagen 1033 1103 3e-9 PFAM
Pfam:Collagen 1063 1130 3.4e-9 PFAM
low complexity region 1150 1168 N/A INTRINSIC
Pfam:Collagen 1207 1281 5.5e-9 PFAM
Pfam:Collagen 1261 1324 8.4e-10 PFAM
Pfam:Collagen 1323 1384 3.8e-12 PFAM
low complexity region 1438 1466 N/A INTRINSIC
internal_repeat_4 1467 1502 1.5e-7 PROSPERO
internal_repeat_2 1468 1529 1.96e-8 PROSPERO
Pfam:Collagen 1544 1606 2.4e-9 PFAM
COLFI 1644 1845 1.28e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036300
SMART Domains Protein: ENSMUSP00000043816
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
TSPN 43 223 1.1e-5 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 356 372 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 455 467 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
Pfam:Collagen 609 670 2.1e-10 PFAM
Pfam:Collagen 666 731 3.7e-10 PFAM
low complexity region 790 808 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 858 880 N/A INTRINSIC
low complexity region 886 910 N/A INTRINSIC
low complexity region 912 946 N/A INTRINSIC
Pfam:Collagen 1012 1080 2.8e-8 PFAM
Pfam:Collagen 1033 1103 3e-9 PFAM
Pfam:Collagen 1063 1130 3.4e-9 PFAM
low complexity region 1150 1168 N/A INTRINSIC
Pfam:Collagen 1207 1281 5.5e-9 PFAM
Pfam:Collagen 1261 1324 8.4e-10 PFAM
Pfam:Collagen 1323 1384 3.8e-12 PFAM
low complexity region 1438 1466 N/A INTRINSIC
internal_repeat_4 1467 1502 1.5e-7 PROSPERO
internal_repeat_2 1468 1529 1.96e-8 PROSPERO
Pfam:Collagen 1544 1606 2.4e-9 PFAM
COLFI 1644 1845 1.28e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149856
Predicted Effect probably benign
Transcript: ENSMUST00000183913
SMART Domains Protein: ENSMUSP00000139182
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 1 60 2.7e-12 PFAM
Pfam:Collagen 34 114 6.6e-8 PFAM
Pfam:Collagen 87 163 3.6e-9 PFAM
low complexity region 175 202 N/A INTRINSIC
low complexity region 214 232 N/A INTRINSIC
Pfam:Collagen 271 338 9.1e-11 PFAM
Pfam:Collagen 328 388 5.4e-11 PFAM
Pfam:Collagen 387 442 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183913
SMART Domains Protein: ENSMUSP00000139182
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 1 60 2.7e-12 PFAM
Pfam:Collagen 34 114 6.6e-8 PFAM
Pfam:Collagen 87 163 3.6e-9 PFAM
low complexity region 175 202 N/A INTRINSIC
low complexity region 214 232 N/A INTRINSIC
Pfam:Collagen 271 338 9.1e-11 PFAM
Pfam:Collagen 328 388 5.4e-11 PFAM
Pfam:Collagen 387 442 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184067
SMART Domains Protein: ENSMUSP00000139173
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 23 87 2.1e-8 PFAM
Pfam:Collagen 57 145 8.3e-8 PFAM
Pfam:Collagen 115 200 9.9e-8 PFAM
low complexity region 202 223 N/A INTRINSIC
low complexity region 243 265 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 331 N/A INTRINSIC
internal_repeat_1 337 442 5.17e-20 PROSPERO
Pfam:Collagen 448 515 1.5e-9 PFAM
Pfam:Collagen 478 543 2e-10 PFAM
Pfam:Collagen 502 566 2.5e-9 PFAM
Pfam:Collagen 532 617 4.4e-7 PFAM
Pfam:Collagen 594 660 8.2e-11 PFAM
Pfam:Collagen 649 709 1.4e-10 PFAM
Pfam:Collagen 708 769 2e-12 PFAM
Pfam:Collagen 752 829 5e-8 PFAM
Pfam:Collagen 878 939 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184067
SMART Domains Protein: ENSMUSP00000139173
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 23 87 2.1e-8 PFAM
Pfam:Collagen 57 145 8.3e-8 PFAM
Pfam:Collagen 115 200 9.9e-8 PFAM
low complexity region 202 223 N/A INTRINSIC
low complexity region 243 265 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 331 N/A INTRINSIC
internal_repeat_1 337 442 5.17e-20 PROSPERO
Pfam:Collagen 448 515 1.5e-9 PFAM
Pfam:Collagen 478 543 2e-10 PFAM
Pfam:Collagen 502 566 2.5e-9 PFAM
Pfam:Collagen 532 617 4.4e-7 PFAM
Pfam:Collagen 594 660 8.2e-11 PFAM
Pfam:Collagen 649 709 1.4e-10 PFAM
Pfam:Collagen 708 769 2e-12 PFAM
Pfam:Collagen 752 829 5e-8 PFAM
Pfam:Collagen 878 939 2.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXVII collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein forms a homotrimeric triple helical procollagen that undergoes proteolytic processing during fibril formation. Transgenic mice lacking a portion of the collagenous domain in the encoded protein exhibit skeletal abnormalities, chondrodysplasia and die at birth because of a lung defect. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an in frame deletion display neonatal lethality, respiratory failure, and severe chondrodysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Col27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Col27a1 APN 4 63300741 splice site probably benign
IGL01461:Col27a1 APN 4 63224243 missense probably damaging 1.00
IGL01534:Col27a1 APN 4 63225782 missense probably benign 0.12
IGL01738:Col27a1 APN 4 63263779 splice site probably benign
IGL01810:Col27a1 APN 4 63225631 missense probably benign 0.21
IGL02127:Col27a1 APN 4 63225142 missense possibly damaging 0.60
IGL02290:Col27a1 APN 4 63225926 missense probably damaging 1.00
IGL02374:Col27a1 APN 4 63293249 missense possibly damaging 0.86
IGL02548:Col27a1 APN 4 63318255 splice site probably benign
IGL02792:Col27a1 APN 4 63315583 missense unknown
IGL02931:Col27a1 APN 4 63331426 utr 3 prime probably benign
IGL03107:Col27a1 APN 4 63324632 splice site probably benign
IGL03121:Col27a1 APN 4 63225209 missense probably benign 0.26
IGL03334:Col27a1 APN 4 63314722 missense probably damaging 1.00
R0005:Col27a1 UTSW 4 63225400 missense probably benign 0.04
R0025:Col27a1 UTSW 4 63275977 missense probably damaging 1.00
R0141:Col27a1 UTSW 4 63265633 critical splice acceptor site probably null
R0196:Col27a1 UTSW 4 63224266 missense probably benign 0.02
R0359:Col27a1 UTSW 4 63314727 critical splice donor site probably null
R0375:Col27a1 UTSW 4 63225661 missense probably benign 0.23
R0432:Col27a1 UTSW 4 63225611 missense possibly damaging 0.87
R0499:Col27a1 UTSW 4 63300741 splice site probably benign
R0891:Col27a1 UTSW 4 63305183 critical splice acceptor site probably null
R1239:Col27a1 UTSW 4 63318915 splice site probably benign
R1297:Col27a1 UTSW 4 63265631 splice site probably benign
R1299:Col27a1 UTSW 4 63265631 splice site probably benign
R1322:Col27a1 UTSW 4 63328566 utr 3 prime probably benign
R1342:Col27a1 UTSW 4 63257114 critical splice donor site probably null
R1446:Col27a1 UTSW 4 63224803 missense probably damaging 1.00
R1629:Col27a1 UTSW 4 63329863 utr 3 prime probably benign
R1644:Col27a1 UTSW 4 63328631 utr 3 prime probably benign
R1774:Col27a1 UTSW 4 63225713 missense probably damaging 1.00
R1807:Col27a1 UTSW 4 63331349 utr 3 prime probably benign
R1952:Col27a1 UTSW 4 63283893 intron probably null
R1957:Col27a1 UTSW 4 63277794 missense probably benign 0.03
R1970:Col27a1 UTSW 4 63273117 splice site probably benign
R2164:Col27a1 UTSW 4 63225424 missense probably benign 0.21
R3774:Col27a1 UTSW 4 63314726 missense probably benign 0.00
R4078:Col27a1 UTSW 4 63224432 missense probably damaging 1.00
R4353:Col27a1 UTSW 4 63225631 missense probably benign 0.21
R4611:Col27a1 UTSW 4 63293506 missense probably damaging 1.00
R4708:Col27a1 UTSW 4 63283913 missense probably benign 0.01
R4884:Col27a1 UTSW 4 63275960 missense possibly damaging 0.77
R5149:Col27a1 UTSW 4 63331427 utr 3 prime probably benign
R5411:Col27a1 UTSW 4 63224665 missense probably damaging 1.00
R5451:Col27a1 UTSW 4 63225239 missense probably damaging 0.98
R5615:Col27a1 UTSW 4 63281114 missense probably damaging 0.96
R5657:Col27a1 UTSW 4 63225310 missense probably damaging 0.97
R5838:Col27a1 UTSW 4 63225528 missense probably damaging 1.00
R6230:Col27a1 UTSW 4 63224282 missense probably damaging 1.00
R6326:Col27a1 UTSW 4 63324441 utr 3 prime probably benign
R6457:Col27a1 UTSW 4 63319464 utr 3 prime probably benign
R6624:Col27a1 UTSW 4 63225011 missense probably benign 0.00
R6792:Col27a1 UTSW 4 63317503 missense unknown
R6848:Col27a1 UTSW 4 63302371 missense probably benign
R6962:Col27a1 UTSW 4 63319501 utr 3 prime probably benign
R7053:Col27a1 UTSW 4 63333167 utr 3 prime probably benign
R7206:Col27a1 UTSW 4 63235346 missense probably benign 0.29
R7586:Col27a1 UTSW 4 63225041 missense probably damaging 1.00
R7698:Col27a1 UTSW 4 63225718 missense possibly damaging 0.78
R7714:Col27a1 UTSW 4 63324486 critical splice donor site probably null
Z1176:Col27a1 UTSW 4 63225788 missense probably damaging 0.99
Z1177:Col27a1 UTSW 4 63281289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTTGGCTCTCAAATCTGAAC -3'
(R):5'- GCAGCCATGCCAATGTCTGATTATG -3'

Sequencing Primer
(F):5'- ATCTGAACCATCTGGCAGTG -3'
(R):5'- ATGCCAATGTCTGATTATGGGTATG -3'
Posted On2013-10-16