Incidental Mutation 'R0786:Gpr12'
ID76852
Institutional Source Beutler Lab
Gene Symbol Gpr12
Ensembl Gene ENSMUSG00000041468
Gene NameG-protein coupled receptor 12
SynonymsGpcr12, Gpcr01, Gpcr20
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location146582398-146585239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146583504 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 44 (S44T)
Ref Sequence ENSEMBL: ENSMUSP00000143653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036211] [ENSMUST00000197431] [ENSMUST00000197825] [ENSMUST00000200112]
Predicted Effect probably benign
Transcript: ENSMUST00000036211
AA Change: S203T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038245
Gene: ENSMUSG00000041468
AA Change: S203T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 236 2.9e-7 PFAM
Pfam:7tm_1 61 301 5.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196096
Predicted Effect probably benign
Transcript: ENSMUST00000197431
AA Change: S203T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142889
Gene: ENSMUSG00000041468
AA Change: S203T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 236 2.9e-7 PFAM
Pfam:7tm_1 61 301 2.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197825
SMART Domains Protein: ENSMUSP00000143415
Gene: ENSMUSG00000041468

DomainStartEndE-ValueType
Pfam:7tm_1 61 152 5.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200112
AA Change: S44T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143653
Gene: ENSMUSG00000041468
AA Change: S44T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
transmembrane domain 35 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200363
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in obesity, increased cholesterol, glucose and triglyceride levels and decreased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Gpr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Gpr12 APN 5 146583923 missense probably damaging 1.00
IGL03225:Gpr12 APN 5 146583951 missense probably damaging 1.00
IGL02799:Gpr12 UTSW 5 146583819 missense possibly damaging 0.92
R0380:Gpr12 UTSW 5 146583336 missense probably damaging 1.00
R0591:Gpr12 UTSW 5 146583635 missense probably benign 0.00
R1432:Gpr12 UTSW 5 146583425 missense probably damaging 1.00
R5994:Gpr12 UTSW 5 146583431 missense probably damaging 1.00
R7069:Gpr12 UTSW 5 146583539 missense possibly damaging 0.96
R7269:Gpr12 UTSW 5 146583378 missense probably damaging 1.00
R7354:Gpr12 UTSW 5 146583962 missense probably damaging 1.00
R7863:Gpr12 UTSW 5 146583560 missense possibly damaging 0.87
R7946:Gpr12 UTSW 5 146583560 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAAGGCTGCTACACATCGCTG -3'
(R):5'- GCTATATTACGCCCTGACGTACCAC -3'

Sequencing Primer
(F):5'- CTACACATCGCTGGGAGAC -3'
(R):5'- TGACGTACCACTCCGAGAG -3'
Posted On2013-10-16