Incidental Mutation 'R0786:Prss8'
ID76859
Institutional Source Beutler Lab
Gene Symbol Prss8
Ensembl Gene ENSMUSG00000030800
Gene Nameprotease, serine 8 (prostasin)
Synonyms2410039E18Rik, CAP1, mCAP1, fr
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127925716-127930104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127926474 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 291 (R291Q)
Ref Sequence ENSEMBL: ENSMUSP00000145904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000033070] [ENSMUST00000206124] [ENSMUST00000206568]
Predicted Effect probably benign
Transcript: ENSMUST00000032988
AA Change: R291Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800
AA Change: R291Q

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033070
SMART Domains Protein: ENSMUSP00000033070
Gene: ENSMUSG00000030801

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
CHROMO 69 123 6.6e-8 SMART
Blast:PHD 177 214 4e-6 BLAST
Pfam:MOZ_SAS 235 412 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206124
AA Change: R291Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 or chymotrypsin family of serine proteases. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate via a disulfide bond to form the heterodimeric enzyme. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. This protease exhibits trypsin-like substrate specificity, cleaving protein substrates at the carboxyl terminus of lysine or arginine residues. The encoded protease partially mediates proteolytic activation of the epithelial sodium channel, a regulator of sodium balance, and may also play a role in epithelial barrier formation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Nullizygous mutations result in impaired skin barrier function, dehydration, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Prss8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01737:Prss8 APN 7 127926580 missense probably damaging 1.00
PIT1430001:Prss8 UTSW 7 127922252 unclassified probably benign
R0326:Prss8 UTSW 7 127927176 missense probably benign 0.17
R1381:Prss8 UTSW 7 127929849 small deletion probably benign
R1919:Prss8 UTSW 7 127929858 missense probably benign 0.32
R2074:Prss8 UTSW 7 127927094 missense possibly damaging 0.64
R2075:Prss8 UTSW 7 127927094 missense possibly damaging 0.64
R4492:Prss8 UTSW 7 127929807 missense probably damaging 0.98
R4989:Prss8 UTSW 7 127926463 missense probably benign 0.02
R7286:Prss8 UTSW 7 127926884 missense probably damaging 1.00
R7322:Prss8 UTSW 7 127929563 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGTCCTGGAAGCATGGTCAAC -3'
(R):5'- ACTATTGGCCTGAGGTCTGTCCTG -3'

Sequencing Primer
(F):5'- CTGGAAGCATGGTCAACTTTGAG -3'
(R):5'- TGAGGTCTGTCCTGACAGC -3'
Posted On2013-10-16