Incidental Mutation 'R0786:Adrb3'
ID76861
Institutional Source Beutler Lab
Gene Symbol Adrb3
Ensembl Gene ENSMUSG00000031489
Gene Nameadrenergic receptor, beta 3
SynonymsAdrb-3, Beta-3 AR, Beta-3 adrenoceptor, beta3-adrenergic receptor, beta 3-AR
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27225776-27250616 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 27226852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081438] [ENSMUST00000117565] [ENSMUST00000121838] [ENSMUST00000209299]
Predicted Effect probably benign
Transcript: ENSMUST00000081438
SMART Domains Protein: ENSMUSP00000080162
Gene: ENSMUSG00000031489

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000117565
AA Change: Y403C
SMART Domains Protein: ENSMUSP00000113732
Gene: ENSMUSG00000031489
AA Change: Y403C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.8e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.4e-14 PFAM
Pfam:7tm_1 51 343 4.9e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121838
SMART Domains Protein: ENSMUSP00000113006
Gene: ENSMUSG00000031489

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211346
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for targeted null mutations develop greater adiposity, especially on a high-fat diet, and are unresponsive to the beta3-adrenergic receptor agonist, CL316,243. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Adrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0639:Adrb3 UTSW 8 27228265 missense probably damaging 0.97
R1370:Adrb3 UTSW 8 27227770 unclassified probably null
R1449:Adrb3 UTSW 8 27227387 missense probably damaging 1.00
R1874:Adrb3 UTSW 8 27227563 missense probably damaging 1.00
R3426:Adrb3 UTSW 8 27228181 missense probably damaging 1.00
R3428:Adrb3 UTSW 8 27228181 missense probably damaging 1.00
R4941:Adrb3 UTSW 8 27227422 missense probably damaging 1.00
R4989:Adrb3 UTSW 8 27227770 missense probably damaging 1.00
R4994:Adrb3 UTSW 8 27227827 unclassified probably null
R5133:Adrb3 UTSW 8 27227770 missense probably damaging 1.00
R5134:Adrb3 UTSW 8 27227770 missense probably damaging 1.00
R5162:Adrb3 UTSW 8 27227320 missense probably benign 0.25
R5342:Adrb3 UTSW 8 27226781 nonsense probably null
R5656:Adrb3 UTSW 8 27227377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCCCATAGGGTCCATCCTGCAC -3'
(R):5'- CCAATCCCTGGGTCTGAAGCAAAAG -3'

Sequencing Primer
(F):5'- AGTCCCACCCTATAGTTCTAATCCAG -3'
(R):5'- GGTCTGAAGCAAAAGGGAGG -3'
Posted On2013-10-16