Incidental Mutation 'R0786:Cep57'
ID76864
Institutional Source Beutler Lab
Gene Symbol Cep57
Ensembl Gene ENSMUSG00000031922
Gene Namecentrosomal protein 57
Synonyms4931428M20Rik, Tsp57, 3110002L15Rik, 4921510P06Rik
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location13807792-13827107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13809870 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 271 (Y271F)
Ref Sequence ENSEMBL: ENSMUSP00000115338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034396] [ENSMUST00000034398] [ENSMUST00000124883] [ENSMUST00000134674] [ENSMUST00000134746] [ENSMUST00000142494] [ENSMUST00000144484] [ENSMUST00000147115] [ENSMUST00000148086] [ENSMUST00000150893] [ENSMUST00000155679]
Predicted Effect probably benign
Transcript: ENSMUST00000034396
SMART Domains Protein: ENSMUSP00000034396
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
GRAM 65 139 1.57e-11 SMART
Pfam:Myotub-related 192 529 1.7e-152 PFAM
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000034398
AA Change: Y420F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034398
Gene: ENSMUSG00000031922
AA Change: Y420F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 9.8e-67 PFAM
low complexity region 259 271 N/A INTRINSIC
Pfam:Cep57_MT_bd 348 420 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124524
Predicted Effect probably damaging
Transcript: ENSMUST00000124883
AA Change: Y271F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119081
Gene: ENSMUSG00000031922
AA Change: Y271F

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 4.7e-34 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131425
Predicted Effect probably benign
Transcript: ENSMUST00000134674
SMART Domains Protein: ENSMUSP00000121933
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134746
SMART Domains Protein: ENSMUSP00000116713
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 209 1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142494
SMART Domains Protein: ENSMUSP00000114749
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 3.3e-72 PFAM
low complexity region 259 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144484
SMART Domains Protein: ENSMUSP00000114940
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146901
Predicted Effect possibly damaging
Transcript: ENSMUST00000147115
AA Change: Y394F

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116931
Gene: ENSMUSG00000031922
AA Change: Y394F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 2.1e-72 PFAM
low complexity region 254 275 N/A INTRINSIC
Pfam:Cep57_MT_bd 319 394 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148086
AA Change: Y393F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114665
Gene: ENSMUSG00000031922
AA Change: Y393F

DomainStartEndE-ValueType
Pfam:Cep57_CLD 41 218 1e-71 PFAM
low complexity region 232 244 N/A INTRINSIC
Pfam:Cep57_MT_bd 318 393 6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148904
Predicted Effect probably damaging
Transcript: ENSMUST00000150893
AA Change: Y271F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115338
Gene: ENSMUSG00000031922
AA Change: Y271F

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 5.2e-37 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151878
SMART Domains Protein: ENSMUSP00000116847
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 133 1.6e-43 PFAM
low complexity region 147 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155679
SMART Domains Protein: ENSMUSP00000115906
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Pfam:Myotub-related 119 459 6.7e-152 PFAM
Pfam:Y_phosphatase 266 370 3.9e-6 PFAM
low complexity region 544 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Cep57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Cep57 APN 9 13819016 missense probably damaging 1.00
IGL01712:Cep57 APN 9 13813417 missense possibly damaging 0.72
IGL01965:Cep57 APN 9 13821520 unclassified probably benign
IGL02250:Cep57 APN 9 13810643 missense probably damaging 1.00
IGL02378:Cep57 APN 9 13821546 nonsense probably null
IGL02943:Cep57 APN 9 13818853 splice site probably benign
IGL03244:Cep57 APN 9 13818387 nonsense probably null
R0082:Cep57 UTSW 9 13810876 unclassified probably benign
R0330:Cep57 UTSW 9 13816985 missense probably damaging 1.00
R0962:Cep57 UTSW 9 13808743 missense possibly damaging 0.48
R1037:Cep57 UTSW 9 13818979 missense possibly damaging 0.89
R1472:Cep57 UTSW 9 13821554 missense probably benign 0.03
R1773:Cep57 UTSW 9 13816068 missense probably damaging 1.00
R1776:Cep57 UTSW 9 13818874 missense probably damaging 0.99
R4162:Cep57 UTSW 9 13812633 splice site probably null
R4895:Cep57 UTSW 9 13816153 intron probably benign
R4942:Cep57 UTSW 9 13813427 missense probably damaging 0.96
R5310:Cep57 UTSW 9 13818868 missense probably damaging 1.00
R5566:Cep57 UTSW 9 13821575 missense probably damaging 0.99
R5996:Cep57 UTSW 9 13809879 missense probably damaging 0.99
R6058:Cep57 UTSW 9 13810761 missense possibly damaging 0.75
R7065:Cep57 UTSW 9 13818381 missense probably damaging 1.00
R7410:Cep57 UTSW 9 13818684 intron probably benign
R7421:Cep57 UTSW 9 13810673 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATTGCTGTCAACCCAGGAGCTG -3'
(R):5'- GGAACTGAAGGTAGTCTCCCTTGTGG -3'

Sequencing Primer
(F):5'- GTCTGTTTCTCTAGATGAGAACACC -3'
(R):5'- AGTCTCCCTTGTGGTTTGTATG -3'
Posted On2013-10-16