Incidental Mutation 'R0786:Recql5'
ID76870
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R0786 (G1)
Quality Score145
Status Not validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115895802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 563 (I563V)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131566] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000142089] [ENSMUST00000152171] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: I563V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: I563V

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: I563V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: I563V

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131566
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect probably benign
Transcript: ENSMUST00000142089
SMART Domains Protein: ENSMUSP00000138928
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147172
Predicted Effect probably benign
Transcript: ENSMUST00000152171
SMART Domains Protein: ENSMUSP00000139148
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Efr3a A G 15: 65,853,551 D532G possibly damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGTCTCATGCTCCAGTTCCACAG -3'
(R):5'- GAAGATCCCGAAGCTCACAGTGAAG -3'

Sequencing Primer
(F):5'- TGAGAATCCTCTAGGAGCCC -3'
(R):5'- CGAAGCTCACAGTGAAGGTAAG -3'
Posted On2013-10-16