Incidental Mutation 'R0786:Efr3a'
ID76875
Institutional Source Beutler Lab
Gene Symbol Efr3a
Ensembl Gene ENSMUSG00000015002
Gene NameEFR3 homolog A
SynonymsA130089M23Rik, D030063F01Rik, C920006C10Rik
MMRRC Submission 038966-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R0786 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location65787034-65873816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65853551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 532 (D532G)
Ref Sequence ENSEMBL: ENSMUSP00000148418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015146] [ENSMUST00000173858] [ENSMUST00000211878]
Predicted Effect probably benign
Transcript: ENSMUST00000015146
AA Change: D505G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002
AA Change: D505G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173858
AA Change: D505G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134385
Gene: ENSMUSG00000015002
AA Change: D505G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 8e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174749
Predicted Effect possibly damaging
Transcript: ENSMUST00000211878
AA Change: D532G

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000227340
AA Change: D83G
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that plays a role in maintaining an active pool of phosphatidylinositol 4-kinase (PI4K) at the plasma membrane. This protein is thought to be a peripheral membrane protein that associates with the plasma membrane through palmitoylation. Studies indicate that this gene product plays a role in controlling G protein-coupled receptor (GPCR) activity by affecting receptor phosphorylation. Whole exome sequencing studies have implicated mutations in this gene with autism spectrum disorders. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 T C 8: 27,226,852 probably benign Het
Atg2b T C 12: 105,636,508 H1592R probably benign Het
Bpifb1 C T 2: 154,202,661 A16V probably benign Het
Casc1 A G 6: 145,181,757 probably null Het
Cep57 T A 9: 13,809,870 Y271F probably damaging Het
Cfap54 A T 10: 92,967,535 N1548K possibly damaging Het
Chrna6 A T 8: 27,408,380 D103E probably benign Het
Clec12b T C 6: 129,380,688 N69S probably benign Het
Col27a1 T C 4: 63,291,578 probably null Het
Cwh43 T A 5: 73,408,183 Y30* probably null Het
Dsg4 T C 18: 20,449,372 probably null Het
Efna3 T C 3: 89,316,573 N103S probably damaging Het
Fam227a A T 15: 79,626,268 V395D probably benign Het
Fes T A 7: 80,386,920 D93V probably damaging Het
Gbp3 T A 3: 142,570,971 M510K possibly damaging Het
Gpr12 A T 5: 146,583,504 S44T probably damaging Het
Gpr179 T C 11: 97,343,274 N583S probably damaging Het
Hipk1 T C 3: 103,744,304 T1093A probably benign Het
Hspb1 T C 5: 135,889,243 L148P probably damaging Het
Kirrel3 A G 9: 35,034,865 N640S probably damaging Het
Mak G T 13: 41,046,069 Q365K probably benign Het
Melk A G 4: 44,303,649 Y14C unknown Het
Myh7 T C 14: 54,992,873 M1V probably null Het
Nsmf A G 2: 25,060,510 Y330C probably damaging Het
Parp14 A G 16: 35,840,802 F1592S possibly damaging Het
Pnpla6 A T 8: 3,523,317 I394F probably benign Het
Ppl T C 16: 5,089,054 R1126G probably damaging Het
Prss8 C T 7: 127,926,474 R291Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasgrp1 G T 2: 117,300,499 D155E probably benign Het
Recql5 T C 11: 115,895,802 I563V probably benign Het
Rhbg C T 3: 88,244,568 M394I probably benign Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Smg9 T C 7: 24,420,864 F421S probably benign Het
Tgm2 T C 2: 158,124,381 E451G probably damaging Het
Tle1 T A 4: 72,199,361 T21S probably damaging Het
Tmc5 T C 7: 118,627,210 I266T possibly damaging Het
Tmigd3 T A 3: 105,917,002 C96S probably damaging Het
Trdn A T 10: 33,305,081 T361S probably benign Het
Vgll3 A T 16: 65,860,682 Q261L probably benign Het
Vmn2r104 A T 17: 20,042,725 I158K probably benign Het
Zfp964 A G 8: 69,664,081 K444E possibly damaging Het
Other mutations in Efr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Efr3a APN 15 65855417 missense possibly damaging 0.66
IGL01070:Efr3a APN 15 65853078 missense probably benign
IGL01366:Efr3a APN 15 65851150 missense probably benign 0.37
IGL01754:Efr3a APN 15 65854720 missense probably damaging 0.96
IGL02121:Efr3a APN 15 65871150 splice site probably benign
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0139:Efr3a UTSW 15 65845981 missense possibly damaging 0.58
R0449:Efr3a UTSW 15 65842704 missense probably damaging 1.00
R0827:Efr3a UTSW 15 65853551 missense possibly damaging 0.70
R0843:Efr3a UTSW 15 65837423 splice site probably benign
R1433:Efr3a UTSW 15 65869057 intron probably benign
R1572:Efr3a UTSW 15 65854792 critical splice donor site probably null
R2290:Efr3a UTSW 15 65849839 missense probably benign 0.00
R2764:Efr3a UTSW 15 65849770 missense possibly damaging 0.94
R4170:Efr3a UTSW 15 65845982 missense probably damaging 0.98
R4368:Efr3a UTSW 15 65866780 missense possibly damaging 0.82
R4683:Efr3a UTSW 15 65819801 missense probably damaging 1.00
R4797:Efr3a UTSW 15 65857588 missense probably damaging 1.00
R5495:Efr3a UTSW 15 65815409 missense possibly damaging 0.73
R6262:Efr3a UTSW 15 65857474 missense possibly damaging 0.90
R6552:Efr3a UTSW 15 65857490 missense possibly damaging 0.52
R6825:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6833:Efr3a UTSW 15 65842686 missense probably damaging 1.00
R6852:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6853:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6996:Efr3a UTSW 15 65848181 nonsense probably null
R7327:Efr3a UTSW 15 65819778 missense probably damaging 0.98
R7467:Efr3a UTSW 15 65857511 missense possibly damaging 0.65
R7549:Efr3a UTSW 15 65815413 critical splice donor site probably null
R7671:Efr3a UTSW 15 65837434 critical splice acceptor site probably null
R7810:Efr3a UTSW 15 65787173 start gained probably benign
R7830:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7832:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7904:Efr3a UTSW 15 65824678 missense probably damaging 1.00
R7915:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7983:Efr3a UTSW 15 65848135 splice site probably null
R7987:Efr3a UTSW 15 65824678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATCGCCATGACAACAGAGC -3'
(R):5'- TAGCACACGCACTTTCGACAGG -3'

Sequencing Primer
(F):5'- GTATCAGGTGACTCACCAGACTG -3'
(R):5'- GCACTTTCGACAGGTGAGG -3'
Posted On2013-10-16