Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Armc9'

76882

Institutional Source

Beutler Lab

Gene Symbol

Armc9

Ensembl Gene

ENSMUSG00000062590

Gene Name

armadillo repeat containing 9

Synonyms

5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R0787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86154780-86278284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86202505 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 524 (N524D)

Ref Sequence

ENSEMBL: ENSMUSP00000117267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027434] [ENSMUST00000113309] [ENSMUST00000131412] [ENSMUST00000150059] [ENSMUST00000156675]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027434
AA Change: N524D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027434
Gene: ENSMUSG00000062590
AA Change: N524D

Domain	Start	End	E-Value	Type
LisH	7	39	1.8e-4	SMART
low complexity region	175	190	N/A	INTRINSIC
coiled coil region	206	242	N/A	INTRINSIC
SCOP:d1jdha_	377	575	8e-14	SMART
low complexity region	793	807	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113309
AA Change: N524D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108934
Gene: ENSMUSG00000062590
AA Change: N524D

Domain	Start	End	E-Value	Type
LisH	7	39	1.8e-4	SMART
low complexity region	175	190	N/A	INTRINSIC
coiled coil region	206	242	N/A	INTRINSIC
SCOP:d1jdha_	377	575	8e-14	SMART
low complexity region	794	808	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123618

Predicted Effect

probably damaging
Transcript: ENSMUST00000131412
AA Change: N524D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117267
Gene: ENSMUSG00000062590
AA Change: N524D

Domain	Start	End	E-Value	Type
LisH	7	39	1.8e-4	SMART
low complexity region	175	190	N/A	INTRINSIC
coiled coil region	206	242	N/A	INTRINSIC
SCOP:d1jdha_	377	575	4e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135973

Predicted Effect

possibly damaging
Transcript: ENSMUST00000150059
AA Change: N96D

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116908
Gene: ENSMUSG00000062590
AA Change: N96D

Domain	Start	End	E-Value	Type
SCOP:d1qbkb_	1	168	4e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155168

Predicted Effect

probably benign
Transcript: ENSMUST00000156675
AA Change: N4D

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000119749
Gene: ENSMUSG00000062590
AA Change: N4D

Domain	Start	End	E-Value	Type
SCOP:d1qbkb_	6	100	3e-3	SMART

Meta Mutation Damage Score

0.7514

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Armc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Armc9	APN	1	86198339	missense	probably damaging	1.00
IGL00771:Armc9	APN	1	86199835	splice site	probably null
IGL01689:Armc9	APN	1	86274418	missense	probably benign
IGL02143:Armc9	APN	1	86176865	missense	possibly damaging	0.58
IGL02680:Armc9	APN	1	86252278	missense	probably damaging	1.00
IGL02812:Armc9	APN	1	86244571	missense	probably damaging	0.99
IGL02887:Armc9	APN	1	86164835	missense	probably damaging	1.00
IGL03011:Armc9	APN	1	86199916	critical splice donor site	probably null
IGL03309:Armc9	APN	1	86274433	missense	possibly damaging	0.54
R0184:Armc9	UTSW	1	86198370	missense	probably damaging	1.00
R0440:Armc9	UTSW	1	86194262	splice site	probably null
R0849:Armc9	UTSW	1	86257270	missense	probably benign	0.00
R1687:Armc9	UTSW	1	86156955	start codon destroyed	probably null	1.00
R1962:Armc9	UTSW	1	86207974	missense	probably damaging	1.00
R2176:Armc9	UTSW	1	86199892	missense	probably damaging	1.00
R3418:Armc9	UTSW	1	86194338	missense	probably damaging	1.00
R3419:Armc9	UTSW	1	86194338	missense	probably damaging	1.00
R4079:Armc9	UTSW	1	86213129	intron	probably benign
R4112:Armc9	UTSW	1	86188939	missense	possibly damaging	0.80
R4151:Armc9	UTSW	1	86164775	missense	probably damaging	1.00
R4675:Armc9	UTSW	1	86202518	missense	probably damaging	1.00
R4934:Armc9	UTSW	1	86213079	missense	probably damaging	1.00
R4944:Armc9	UTSW	1	86274534	missense	probably damaging	0.98
R5069:Armc9	UTSW	1	86257237	missense	probably benign	0.03
R5070:Armc9	UTSW	1	86257237	missense	probably benign	0.03
R5071:Armc9	UTSW	1	86186116	missense	probably benign	0.01
R5238:Armc9	UTSW	1	86199847	missense	probably benign	0.01
R5386:Armc9	UTSW	1	86198289	missense	probably null	1.00
R5459:Armc9	UTSW	1	86207972	missense	probably damaging	0.97
R6027:Armc9	UTSW	1	86244667	missense	probably damaging	1.00
R6144:Armc9	UTSW	1	86244579	missense	probably benign	0.06
R7111:Armc9	UTSW	1	86159995	missense	probably damaging	1.00
R7237:Armc9	UTSW	1	86164849	missense	possibly damaging	0.82
R7304:Armc9	UTSW	1	86162715	missense	probably benign
R7452:Armc9	UTSW	1	86213092	missense	possibly damaging	0.87
R7555:Armc9	UTSW	1	86275678	missense	probably damaging	1.00
R7805:Armc9	UTSW	1	86196319	missense	probably damaging	1.00
R8513:Armc9	UTSW	1	86162683	missense	probably damaging	1.00
Z1177:Armc9	UTSW	1	86176825	missense	probably damaging	0.97
Z1177:Armc9	UTSW	1	86196355	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCATTGCAGCGTCACACATGGAG -3'
(R):5'- TTGAGGAATCTGCCCTGGAGGAAG -3'

Sequencing Primer
(F):5'- AGGATACCAACTCTCCCCTT -3'
(R):5'- tcttcttcttcttcttcttttctgtg -3'

Posted On

2013-10-16