Incidental Mutation 'R0787:Armc9'
ID76882
Institutional Source Beutler Lab
Gene Symbol Armc9
Ensembl Gene ENSMUSG00000062590
Gene Namearmadillo repeat containing 9
Synonyms5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86154780-86278284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86202505 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 524 (N524D)
Ref Sequence ENSEMBL: ENSMUSP00000117267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027434] [ENSMUST00000113309] [ENSMUST00000131412] [ENSMUST00000150059] [ENSMUST00000156675]
Predicted Effect probably damaging
Transcript: ENSMUST00000027434
AA Change: N524D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027434
Gene: ENSMUSG00000062590
AA Change: N524D

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 793 807 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113309
AA Change: N524D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108934
Gene: ENSMUSG00000062590
AA Change: N524D

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 794 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123618
Predicted Effect probably damaging
Transcript: ENSMUST00000131412
AA Change: N524D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117267
Gene: ENSMUSG00000062590
AA Change: N524D

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 4e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135973
Predicted Effect possibly damaging
Transcript: ENSMUST00000150059
AA Change: N96D

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116908
Gene: ENSMUSG00000062590
AA Change: N96D

DomainStartEndE-ValueType
SCOP:d1qbkb_ 1 168 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155168
Predicted Effect probably benign
Transcript: ENSMUST00000156675
AA Change: N4D

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119749
Gene: ENSMUSG00000062590
AA Change: N4D

DomainStartEndE-ValueType
SCOP:d1qbkb_ 6 100 3e-3 SMART
Meta Mutation Damage Score 0.7514 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phf20l1 T A 15: 66,615,630 probably benign Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Armc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Armc9 APN 1 86198339 missense probably damaging 1.00
IGL00771:Armc9 APN 1 86199835 splice site probably null
IGL01689:Armc9 APN 1 86274418 missense probably benign
IGL02143:Armc9 APN 1 86176865 missense possibly damaging 0.58
IGL02680:Armc9 APN 1 86252278 missense probably damaging 1.00
IGL02812:Armc9 APN 1 86244571 missense probably damaging 0.99
IGL02887:Armc9 APN 1 86164835 missense probably damaging 1.00
IGL03011:Armc9 APN 1 86199916 critical splice donor site probably null
IGL03309:Armc9 APN 1 86274433 missense possibly damaging 0.54
R0184:Armc9 UTSW 1 86198370 missense probably damaging 1.00
R0440:Armc9 UTSW 1 86194262 unclassified probably null
R0849:Armc9 UTSW 1 86257270 missense probably benign 0.00
R1687:Armc9 UTSW 1 86156955 start codon destroyed probably null 1.00
R1962:Armc9 UTSW 1 86207974 missense probably damaging 1.00
R2176:Armc9 UTSW 1 86199892 missense probably damaging 1.00
R3418:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R3419:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R4079:Armc9 UTSW 1 86213129 intron probably benign
R4112:Armc9 UTSW 1 86188939 missense possibly damaging 0.80
R4151:Armc9 UTSW 1 86164775 missense probably damaging 1.00
R4675:Armc9 UTSW 1 86202518 missense probably damaging 1.00
R4934:Armc9 UTSW 1 86213079 missense probably damaging 1.00
R4944:Armc9 UTSW 1 86274534 missense probably damaging 0.98
R5069:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5070:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5071:Armc9 UTSW 1 86186116 missense probably benign 0.01
R5238:Armc9 UTSW 1 86199847 missense probably benign 0.01
R5386:Armc9 UTSW 1 86198289 missense probably null 1.00
R5459:Armc9 UTSW 1 86207972 missense probably damaging 0.97
R6027:Armc9 UTSW 1 86244667 missense probably damaging 1.00
R6144:Armc9 UTSW 1 86244579 missense probably benign 0.06
R7111:Armc9 UTSW 1 86159995 missense probably damaging 1.00
R7237:Armc9 UTSW 1 86164849 missense possibly damaging 0.82
R7304:Armc9 UTSW 1 86162715 missense probably benign
R7452:Armc9 UTSW 1 86213092 missense possibly damaging 0.87
R7555:Armc9 UTSW 1 86275678 missense probably damaging 1.00
R7805:Armc9 UTSW 1 86196319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTGCAGCGTCACACATGGAG -3'
(R):5'- TTGAGGAATCTGCCCTGGAGGAAG -3'

Sequencing Primer
(F):5'- AGGATACCAACTCTCCCCTT -3'
(R):5'- tcttcttcttcttcttcttttctgtg -3'
Posted On2013-10-16