Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Arhgap40'

76889

Institutional Source

Beutler Lab

Gene Symbol

Arhgap40

Ensembl Gene

ENSMUSG00000074625

Gene Name

Rho GTPase activating protein 40

Synonyms

Gm14203

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R0787 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

158512796-158550762 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 158547790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 625 (S625P)

Ref Sequence

ENSEMBL: ENSMUSP00000130349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099133] [ENSMUST00000165398]

AlphaFold

E9Q6X9

Predicted Effect

probably benign
Transcript: ENSMUST00000099133
AA Change: S628P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000096736
Gene: ENSMUSG00000074625
AA Change: S628P

Domain	Start	End	E-Value	Type
low complexity region	123	143	N/A	INTRINSIC
RhoGAP	340	519	1.84e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135838

Predicted Effect

probably benign
Transcript: ENSMUST00000165398
AA Change: S625P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000130349
Gene: ENSMUSG00000074625
AA Change: S625P

Domain	Start	End	E-Value	Type
low complexity region	120	140	N/A	INTRINSIC
RhoGAP	337	516	1.84e-47	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Arhgap40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Arhgap40	APN	2	158531158	missense	probably benign	0.41
IGL00547:Arhgap40	APN	2	158538626	splice site	probably benign
IGL00911:Arhgap40	APN	2	158534716	splice site	probably benign
IGL01084:Arhgap40	APN	2	158543218	missense	probably damaging	1.00
IGL02037:Arhgap40	APN	2	158534822	missense	probably damaging	1.00
IGL02111:Arhgap40	APN	2	158539844	missense	probably damaging	0.99
IGL02131:Arhgap40	APN	2	158531939	splice site	probably null
IGL02552:Arhgap40	APN	2	158546801	missense	probably benign
PIT4305001:Arhgap40	UTSW	2	158531905	missense	probably benign	0.00
R0212:Arhgap40	UTSW	2	158550575	missense	probably damaging	1.00
R0508:Arhgap40	UTSW	2	158546750	missense	probably damaging	1.00
R1075:Arhgap40	UTSW	2	158549647	missense	possibly damaging	0.54
R1201:Arhgap40	UTSW	2	158534769	missense	probably damaging	1.00
R1511:Arhgap40	UTSW	2	158527161	missense	probably benign
R1519:Arhgap40	UTSW	2	158546801	missense	probably benign
R1567:Arhgap40	UTSW	2	158546799	missense	probably damaging	1.00
R1662:Arhgap40	UTSW	2	158539270	missense	probably damaging	1.00
R4120:Arhgap40	UTSW	2	158532330	missense	probably benign	0.02
R4592:Arhgap40	UTSW	2	158546709	missense	possibly damaging	0.88
R4678:Arhgap40	UTSW	2	158532306	missense	probably benign	0.01
R4818:Arhgap40	UTSW	2	158539719	missense	probably damaging	1.00
R4953:Arhgap40	UTSW	2	158543406	missense	possibly damaging	0.57
R5108:Arhgap40	UTSW	2	158547679	missense	probably damaging	1.00
R5578:Arhgap40	UTSW	2	158531206	missense	probably damaging	0.99
R6924:Arhgap40	UTSW	2	158527146	missense	probably benign	0.00
R6931:Arhgap40	UTSW	2	158531218	missense	probably benign	0.00
R7028:Arhgap40	UTSW	2	158531374	critical splice donor site	probably null
R7253:Arhgap40	UTSW	2	158547656	missense	probably benign
R7385:Arhgap40	UTSW	2	158543227	missense	probably damaging	1.00
R7670:Arhgap40	UTSW	2	158531925	missense	probably benign	0.03
R7813:Arhgap40	UTSW	2	158538700	missense	probably benign	0.00
R7824:Arhgap40	UTSW	2	158534746	missense	probably damaging	1.00
R8179:Arhgap40	UTSW	2	158539856	missense	probably damaging	1.00
R8559:Arhgap40	UTSW	2	158541801	missense	probably damaging	1.00
R8799:Arhgap40	UTSW	2	158512838	missense	probably benign	0.33
R8804:Arhgap40	UTSW	2	158547706	missense	probably benign	0.00
R9096:Arhgap40	UTSW	2	158547664	missense	probably benign	0.01
R9097:Arhgap40	UTSW	2	158547664	missense	probably benign	0.01
R9222:Arhgap40	UTSW	2	158546772	missense	probably damaging	1.00
Z1176:Arhgap40	UTSW	2	158534885	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAAAGTGGCAAAGATCCAGGTCC -3'
(R):5'- CATGCACCGTCTGATCTACAGTAGC -3'

Sequencing Primer
(F):5'- CAAAGATCCAGGTCCAGGCG -3'
(R):5'- ttaaaatCAGTAATGAATGGTGGCCC -3'

Posted On

2013-10-16