Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Pirb'

76900

Institutional Source

Beutler Lab

Gene Symbol

Pirb

Ensembl Gene

ENSMUSG00000058818

Gene Name

paired Ig-like receptor B

Synonyms

Lilrb3, Gp91

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0787 (G1)

Quality Score

103

Status

Not validated

Chromosome

Chromosomal Location

3711409-3720391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3717638 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 287 (L287Q)

Ref Sequence

ENSEMBL: ENSMUSP00000077546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078451]

Predicted Effect

probably benign
Transcript: ENSMUST00000078451
AA Change: L287Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818
AA Change: L287Q

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	34	118	1.8e-3	SMART
IG	129	315	1.2e-4	SMART
IG_like	237	302	6.2e-4	SMART
IG_like	328	415	3.4e-2	SMART
IG_like	435	502	1e-2	SMART
IG	529	618	3.6e-5	SMART
low complexity region	624	637	N/A	INTRINSIC
transmembrane domain	641	663	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129493

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136238

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155131

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Pirb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pirb	APN	7	3717406	missense	probably damaging	0.99
IGL01744:Pirb	APN	7	3717176	nonsense	probably null
IGL01755:Pirb	APN	7	3717170	missense	probably benign	0.16
IGL02580:Pirb	APN	7	3714206	splice site	probably null
IGL02941:Pirb	APN	7	3717378	missense	probably damaging	1.00
R0394:Pirb	UTSW	7	3719248	missense	probably benign	0.08
R0680:Pirb	UTSW	7	3717361	missense	possibly damaging	0.94
R0790:Pirb	UTSW	7	3717638	missense	probably benign
R0832:Pirb	UTSW	7	3717638	missense	probably benign
R1124:Pirb	UTSW	7	3719732	missense	probably benign	0.02
R1178:Pirb	UTSW	7	3717638	missense	probably benign
R1180:Pirb	UTSW	7	3717638	missense	probably benign
R1181:Pirb	UTSW	7	3717638	missense	probably benign
R1281:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1343:Pirb	UTSW	7	3717638	missense	probably benign
R1579:Pirb	UTSW	7	3717638	missense	probably benign
R1699:Pirb	UTSW	7	3717638	missense	probably benign
R1768:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1909:Pirb	UTSW	7	3714588	missense	probably benign	0.33
R1965:Pirb	UTSW	7	3717638	missense	probably benign
R1966:Pirb	UTSW	7	3717638	missense	probably benign
R2004:Pirb	UTSW	7	3717638	missense	probably benign
R2305:Pirb	UTSW	7	3712991	missense	probably benign	0.00
R2931:Pirb	UTSW	7	3717206	missense	probably benign	0.08
R3858:Pirb	UTSW	7	3717663	missense	possibly damaging	0.54
R3928:Pirb	UTSW	7	3717638	missense	probably benign
R3938:Pirb	UTSW	7	3717638	missense	probably benign
R4119:Pirb	UTSW	7	3717575	missense	probably damaging	1.00
R4174:Pirb	UTSW	7	3716032	critical splice donor site	probably null
R4248:Pirb	UTSW	7	3719298	missense	probably damaging	1.00
R4827:Pirb	UTSW	7	3717603	missense	probably benign
R4828:Pirb	UTSW	7	3717603	missense	probably benign
R4829:Pirb	UTSW	7	3717603	missense	probably benign
R4830:Pirb	UTSW	7	3717603	missense	probably benign
R4870:Pirb	UTSW	7	3712662	missense	probably benign	0.00
R4909:Pirb	UTSW	7	3719362	nonsense	probably null
R5146:Pirb	UTSW	7	3712621	utr 3 prime	probably benign
R5244:Pirb	UTSW	7	3716063	missense	probably benign	0.32
R5323:Pirb	UTSW	7	3716599	missense	possibly damaging	0.85
R5921:Pirb	UTSW	7	3716694	nonsense	probably null
R6316:Pirb	UTSW	7	3717823	missense	probably damaging	1.00
R6502:Pirb	UTSW	7	3717393	missense	probably benign	0.00
R6811:Pirb	UTSW	7	3719642	missense	possibly damaging	0.91
R7216:Pirb	UTSW	7	3716274	missense	probably benign	0.00
R7275:Pirb	UTSW	7	3716178	missense	probably benign	0.00
R7327:Pirb	UTSW	7	3717188	nonsense	probably null
R7582:Pirb	UTSW	7	3713818	critical splice donor site	probably null
R7717:Pirb	UTSW	7	3717783	missense	not run
R7717:Pirb	UTSW	7	3717801	missense	not run
R7807:Pirb	UTSW	7	3719865	missense	possibly damaging	0.55
R7844:Pirb	UTSW	7	3719411	nonsense	probably null
R7927:Pirb	UTSW	7	3719411	nonsense	probably null
X0025:Pirb	UTSW	7	3717268	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACCGTAACATCTGAATGCCCCTG -3'
(R):5'- TCTGGGCCACTTTCCAACACAC -3'

Sequencing Primer
(F):5'- TCCTATAATAAACAGGGCTCGG -3'
(R):5'- ACCATCAAGGCTGAACCAGG -3'

Posted On

2013-10-16