Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Lig1'

76901

Institutional Source

Beutler Lab

Gene Symbol

Lig1

Ensembl Gene

ENSMUSG00000056394

Gene Name

ligase I, DNA, ATP-dependent

Synonyms

LigI, mLigI

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13277283-13311433 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 13299069 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 499 (K499Q)

Ref Sequence

ENSEMBL: ENSMUSP00000136972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000165964] [ENSMUST00000177588]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000098814
AA Change: K499Q

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: K499Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	8.6e-50	PFAM
Pfam:DNA_ligase_A_M	556	760	3.4e-67	PFAM
Pfam:DNA_ligase_A_C	785	896	9.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123846

SMART Domains

Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138453

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147735

SMART Domains

Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148471

SMART Domains

Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156525

SMART Domains

Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165964
AA Change: K499Q

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: K499Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	302	478	1.7e-40	PFAM
Pfam:DNA_ligase_A_M	556	760	1.1e-69	PFAM
Pfam:DNA_ligase_A_C	785	896	1.6e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177588
AA Change: K499Q

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: K499Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	8.6e-50	PFAM
Pfam:DNA_ligase_A_M	556	760	3.4e-67	PFAM
Pfam:DNA_ligase_A_C	785	896	9.4e-28	PFAM

Meta Mutation Damage Score

0.1017

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Lig1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Lig1	APN	7	13301452	nonsense	probably null
IGL00499:Lig1	APN	7	13298830	critical splice donor site	probably null
IGL01465:Lig1	APN	7	13296391	missense	probably benign	0.19
IGL01804:Lig1	APN	7	13309206	missense	probably benign	0.43
IGL02068:Lig1	APN	7	13292451	splice site	probably benign
IGL02955:Lig1	APN	7	13296347	missense	probably damaging	0.99
IGL03188:Lig1	APN	7	13311107	splice site	probably benign
IGL03327:Lig1	APN	7	13303855	missense	probably damaging	1.00
IGL03411:Lig1	APN	7	13296768	missense	probably damaging	1.00
PIT4142001:Lig1	UTSW	7	13305924	frame shift	probably null
R0085:Lig1	UTSW	7	13307570	missense	possibly damaging	0.66
R0348:Lig1	UTSW	7	13309197	missense	probably damaging	1.00
R0362:Lig1	UTSW	7	13296804	unclassified	probably benign
R1170:Lig1	UTSW	7	13292153	missense	probably benign	0.00
R1371:Lig1	UTSW	7	13288685	missense	probably damaging	1.00
R1610:Lig1	UTSW	7	13285340	missense	probably damaging	1.00
R1809:Lig1	UTSW	7	13300355	splice site	probably benign
R1986:Lig1	UTSW	7	13309142	nonsense	probably null
R2106:Lig1	UTSW	7	13305938	missense	probably damaging	1.00
R2343:Lig1	UTSW	7	13292195	splice site	probably null
R2380:Lig1	UTSW	7	13303796	splice site	probably benign
R3545:Lig1	UTSW	7	13292163	missense	possibly damaging	0.82
R4669:Lig1	UTSW	7	13311028	missense	probably damaging	1.00
R4928:Lig1	UTSW	7	13298738	missense	probably damaging	1.00
R5167:Lig1	UTSW	7	13311058	missense	probably damaging	0.97
R5249:Lig1	UTSW	7	13308507	missense	possibly damaging	0.60
R5351:Lig1	UTSW	7	13300949	missense	probably damaging	1.00
R5373:Lig1	UTSW	7	13305923	frame shift	probably null
R5607:Lig1	UTSW	7	13306008	missense	probably damaging	0.97
R5608:Lig1	UTSW	7	13306008	missense	probably damaging	0.97
R5620:Lig1	UTSW	7	13286606	missense	possibly damaging	0.66
R5799:Lig1	UTSW	7	13296258	missense	possibly damaging	0.67
R6057:Lig1	UTSW	7	13288672	missense	probably damaging	0.99
R6897:Lig1	UTSW	7	13305914	missense	probably damaging	1.00
R7202:Lig1	UTSW	7	13291249	missense	probably benign	0.00
R7454:Lig1	UTSW	7	13288721	missense	probably damaging	0.99
R7548:Lig1	UTSW	7	13301418	missense	possibly damaging	0.79
R7596:Lig1	UTSW	7	13305998	missense	probably damaging	1.00
R7597:Lig1	UTSW	7	13296344	missense	probably benign
R7688:Lig1	UTSW	7	13289463	missense	probably benign
R7733:Lig1	UTSW	7	13296231	missense	possibly damaging	0.87
R8104:Lig1	UTSW	7	13286565	missense	possibly damaging	0.46
R8887:Lig1	UTSW	7	13296787	missense	probably damaging	1.00
R9025:Lig1	UTSW	7	13303820	missense	probably damaging	1.00
R9321:Lig1	UTSW	7	13301009	missense	probably damaging	1.00
X0020:Lig1	UTSW	7	13296774	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- AGAATGCACTTGGGCAGCCTAC -3'
(R):5'- AAGCCCTAATCCTCTCTGTGCTGG -3'

Sequencing Primer
(F):5'- GGGCAGCCTACCTCATTC -3'
(R):5'- ATTATGAGTAGTCACCAGCCTC -3'

Posted On

2013-10-16