Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Pkd1l2'

76906

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l2

Ensembl Gene

ENSMUSG00000034416

Gene Name

polycystic kidney disease 1 like 2

Synonyms

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116995679-117082449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117076177 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 235 (D235G)

Ref Sequence

ENSEMBL: ENSMUSP00000104721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098375
AA Change: D235G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: D235G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	1.8e-18	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	510	886	1.8e-13	PFAM
low complexity region	1050	1060	N/A	INTRINSIC
GPS	1278	1327	1.61e-11	SMART
transmembrane domain	1346	1365	N/A	INTRINSIC
LH2	1390	1509	6.05e-13	SMART
transmembrane domain	1552	1574	N/A	INTRINSIC
transmembrane domain	1589	1611	N/A	INTRINSIC
transmembrane domain	1815	1837	N/A	INTRINSIC
transmembrane domain	1852	1874	N/A	INTRINSIC
transmembrane domain	1940	1962	N/A	INTRINSIC
Pfam:PKD_channel	1980	2403	6.4e-107	PFAM
Pfam:Ion_trans	2187	2396	2.5e-12	PFAM
low complexity region	2441	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109093
AA Change: D235G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: D235G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	6.9e-19	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	519	883	7e-11	PFAM
low complexity region	1051	1061	N/A	INTRINSIC
GPS	1279	1328	1.61e-11	SMART
transmembrane domain	1347	1366	N/A	INTRINSIC
LH2	1391	1510	6.05e-13	SMART
transmembrane domain	1553	1575	N/A	INTRINSIC
transmembrane domain	1590	1612	N/A	INTRINSIC
transmembrane domain	1816	1838	N/A	INTRINSIC
transmembrane domain	1853	1875	N/A	INTRINSIC
transmembrane domain	1941	1963	N/A	INTRINSIC
Pfam:PKD_channel	1981	2403	5.9e-106	PFAM
Pfam:Ion_trans	2138	2409	3.4e-12	PFAM
low complexity region	2442	2459	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Pkd1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Pkd1l2	APN	8	117059520	nonsense	probably null
IGL01353:Pkd1l2	APN	8	117057443	missense	probably benign	0.24
IGL01362:Pkd1l2	APN	8	117021856	missense	probably damaging	1.00
IGL01486:Pkd1l2	APN	8	117059592	missense	probably benign
IGL01672:Pkd1l2	APN	8	117080732	missense	possibly damaging	0.94
IGL01696:Pkd1l2	APN	8	117056387	missense	probably benign	0.12
IGL01819:Pkd1l2	APN	8	116998174	missense	probably damaging	1.00
IGL01833:Pkd1l2	APN	8	117060525	missense	probably benign	0.00
IGL01981:Pkd1l2	APN	8	117016916	missense	probably benign	0.04
IGL02066:Pkd1l2	APN	8	117009564	splice site	probably benign
IGL02381:Pkd1l2	APN	8	117035800	splice site	probably benign
IGL02416:Pkd1l2	APN	8	117040835	missense	possibly damaging	0.82
IGL02736:Pkd1l2	APN	8	117040666	missense	probably benign	0.00
IGL02828:Pkd1l2	APN	8	117029559	missense	probably benign
IGL02861:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02862:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02883:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02884:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02894:Pkd1l2	APN	8	117013891	missense	probably damaging	0.97
IGL02900:Pkd1l2	APN	8	117024091	missense	probably benign	0.03
IGL02901:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02929:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02941:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02957:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02969:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03028:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03059:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03065:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03066:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03083:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03084:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03124:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03162:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03165:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03335:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03357:Pkd1l2	APN	8	116995809	missense	probably damaging	1.00
IGL02835:Pkd1l2	UTSW	8	117065745	missense	probably benign	0.07
PIT4453001:Pkd1l2	UTSW	8	117022022	missense	probably benign	0.00
R0127:Pkd1l2	UTSW	8	117050048	splice site	probably benign
R0309:Pkd1l2	UTSW	8	116997576	missense	probably damaging	0.99
R0365:Pkd1l2	UTSW	8	117021850	missense	probably benign	0.02
R0526:Pkd1l2	UTSW	8	117082260	missense	probably damaging	1.00
R0571:Pkd1l2	UTSW	8	117082218	missense	probably benign	0.01
R0716:Pkd1l2	UTSW	8	117051100	missense	probably damaging	1.00
R0893:Pkd1l2	UTSW	8	117044492	missense	probably damaging	0.99
R1256:Pkd1l2	UTSW	8	117019543	critical splice acceptor site	probably null
R1391:Pkd1l2	UTSW	8	117054934	missense	possibly damaging	0.87
R1474:Pkd1l2	UTSW	8	117065497	splice site	probably benign
R1491:Pkd1l2	UTSW	8	117028408	missense	probably damaging	1.00
R1520:Pkd1l2	UTSW	8	117046159	missense	probably benign	0.00
R1521:Pkd1l2	UTSW	8	117065500	splice site	probably null
R1544:Pkd1l2	UTSW	8	117038235	frame shift	probably null
R1558:Pkd1l2	UTSW	8	117082252	missense	possibly damaging	0.94
R1673:Pkd1l2	UTSW	8	117040775	missense	probably benign	0.00
R1691:Pkd1l2	UTSW	8	117056419	missense	possibly damaging	0.60
R1754:Pkd1l2	UTSW	8	117030719	missense	possibly damaging	0.81
R1857:Pkd1l2	UTSW	8	117040669	missense	possibly damaging	0.70
R1939:Pkd1l2	UTSW	8	117046182	nonsense	probably null
R1955:Pkd1l2	UTSW	8	117043361	missense	probably benign
R1957:Pkd1l2	UTSW	8	117030682	missense	probably damaging	1.00
R1959:Pkd1l2	UTSW	8	117043231	critical splice donor site	probably null
R2024:Pkd1l2	UTSW	8	117019533	missense	probably benign
R2046:Pkd1l2	UTSW	8	116999955	missense	probably damaging	1.00
R2102:Pkd1l2	UTSW	8	117081469	missense	probably damaging	0.98
R2116:Pkd1l2	UTSW	8	117030722	missense	possibly damaging	0.93
R2148:Pkd1l2	UTSW	8	117056325	missense	probably damaging	0.98
R2251:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2252:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2366:Pkd1l2	UTSW	8	117043317	missense	probably benign	0.01
R2566:Pkd1l2	UTSW	8	117019494	missense	probably damaging	1.00
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2985:Pkd1l2	UTSW	8	117065551	missense	probably benign	0.00
R3055:Pkd1l2	UTSW	8	117068315	critical splice acceptor site	probably null
R3436:Pkd1l2	UTSW	8	117040739	missense	probably benign	0.01
R4732:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4733:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4763:Pkd1l2	UTSW	8	117019429	missense	probably damaging	0.96
R4789:Pkd1l2	UTSW	8	117011575	missense	probably damaging	0.99
R4921:Pkd1l2	UTSW	8	117054885	missense	probably benign	0.03
R4921:Pkd1l2	UTSW	8	117072549	missense	probably damaging	0.97
R4999:Pkd1l2	UTSW	8	117047374	splice site	probably null
R5057:Pkd1l2	UTSW	8	117055008	missense	probably benign	0.21
R5209:Pkd1l2	UTSW	8	117056442	missense	probably benign	0.23
R5241:Pkd1l2	UTSW	8	117035118	missense	probably damaging	1.00
R5480:Pkd1l2	UTSW	8	117030649	missense	probably damaging	0.99
R5501:Pkd1l2	UTSW	8	117065830	missense	probably damaging	0.98
R5533:Pkd1l2	UTSW	8	117068116	missense	probably benign	0.03
R5582:Pkd1l2	UTSW	8	117040783	nonsense	probably null
R5610:Pkd1l2	UTSW	8	117042320	missense	probably benign	0.04
R5770:Pkd1l2	UTSW	8	117055018	missense	probably damaging	1.00
R5854:Pkd1l2	UTSW	8	117065746	missense	possibly damaging	0.48
R5867:Pkd1l2	UTSW	8	117055011	missense	probably damaging	0.96
R5881:Pkd1l2	UTSW	8	116997582	missense	probably damaging	0.99
R5906:Pkd1l2	UTSW	8	117029648	missense	probably damaging	1.00
R5909:Pkd1l2	UTSW	8	117024056	missense	probably benign	0.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6084:Pkd1l2	UTSW	8	117013987	missense	probably damaging	1.00
R6122:Pkd1l2	UTSW	8	117082368	missense	probably benign	0.02
R6216:Pkd1l2	UTSW	8	117081470	missense	probably damaging	1.00
R6406:Pkd1l2	UTSW	8	117035847	missense	probably damaging	0.99
R6417:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6420:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6601:Pkd1l2	UTSW	8	117040666	missense	probably benign	0.00
R6743:Pkd1l2	UTSW	8	117030631	missense	probably damaging	1.00
R7053:Pkd1l2	UTSW	8	117013942	missense	probably damaging	1.00
R7144:Pkd1l2	UTSW	8	117076131	nonsense	probably null
R7148:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7169:Pkd1l2	UTSW	8	117040835	missense	possibly damaging	0.82
R7217:Pkd1l2	UTSW	8	116995797	missense	probably benign	0.24
R7310:Pkd1l2	UTSW	8	117024034	missense	probably benign
R7382:Pkd1l2	UTSW	8	117054871	missense	possibly damaging	0.95
R7397:Pkd1l2	UTSW	8	117035902	missense	possibly damaging	0.94
R7408:Pkd1l2	UTSW	8	117028479	missense	possibly damaging	0.77
R7437:Pkd1l2	UTSW	8	117030682	missense	probably damaging	0.96
R7492:Pkd1l2	UTSW	8	117068110	missense	probably damaging	1.00
R7496:Pkd1l2	UTSW	8	117060594	missense	possibly damaging	0.89
R7519:Pkd1l2	UTSW	8	117065529	missense	probably benign
R7590:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7623:Pkd1l2	UTSW	8	117029645	missense	probably damaging	1.00
R7768:Pkd1l2	UTSW	8	117054860	critical splice donor site	probably null
R7897:Pkd1l2	UTSW	8	116998088	missense	possibly damaging	0.69
R7982:Pkd1l2	UTSW	8	117051187	missense	possibly damaging	0.70
R8024:Pkd1l2	UTSW	8	117076182	missense	possibly damaging	0.85
R8140:Pkd1l2	UTSW	8	117047497	missense	probably benign
R8145:Pkd1l2	UTSW	8	117055003	missense	probably benign
R8228:Pkd1l2	UTSW	8	117065775	missense	probably damaging	0.97
R8252:Pkd1l2	UTSW	8	117040733	missense	probably benign	0.29
R8500:Pkd1l2	UTSW	8	117047563	critical splice acceptor site	probably null
Z1176:Pkd1l2	UTSW	8	117054914	missense	probably damaging	1.00
Z1177:Pkd1l2	UTSW	8	117030691	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTACAGGAAAGCTGTTATCGGG -3'
(R):5'- GGAATCCATGCTCAGGATGCTGTC -3'

Sequencing Primer
(F):5'- AAAGCTGTTATCGGGGAAGTGTC -3'
(R):5'- GTGTCTTGATGGCTAAACAACGAC -3'

Posted On

2013-10-16